Incidental Mutation 'R6893:Olfr876'
ID538161
Institutional Source Beutler Lab
Gene Symbol Olfr876
Ensembl Gene ENSMUSG00000066750
Gene Nameolfactory receptor 876
SynonymsGA_x6K02T2PVTD-31489645-31490577, MOR161-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37803031-37808144 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 37804845 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 311 (*311C)
Ref Sequence ENSEMBL: ENSMUSP00000149930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086064] [ENSMUST00000213368] [ENSMUST00000215287]
Predicted Effect probably null
Transcript: ENSMUST00000086064
AA Change: *311C
SMART Domains Protein: ENSMUSP00000083231
Gene: ENSMUSG00000066750
AA Change: *311C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.6e-47 PFAM
Pfam:7tm_1 40 289 3.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213368
AA Change: *311C
Predicted Effect probably null
Transcript: ENSMUST00000215287
AA Change: *311C
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Olfr876
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Olfr876 APN 9 37804782 missense probably damaging 1.00
IGL01330:Olfr876 APN 9 37804220 missense probably damaging 1.00
IGL02105:Olfr876 APN 9 37804595 missense possibly damaging 0.53
IGL02505:Olfr876 APN 9 37804331 missense probably benign 0.08
R1543:Olfr876 UTSW 9 37803947 missense possibly damaging 0.94
R1768:Olfr876 UTSW 9 37804303 missense probably damaging 1.00
R1960:Olfr876 UTSW 9 37803946 missense probably benign 0.01
R2567:Olfr876 UTSW 9 37804213 missense probably damaging 1.00
R3815:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3816:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3817:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3819:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R4364:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4366:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4620:Olfr876 UTSW 9 37804819 missense probably benign 0.02
R5530:Olfr876 UTSW 9 37804807 missense probably benign 0.00
R6199:Olfr876 UTSW 9 37804881 splice site probably null
R6238:Olfr876 UTSW 9 37804021 missense probably benign 0.26
R7404:Olfr876 UTSW 9 37803961 missense possibly damaging 0.80
R7806:Olfr876 UTSW 9 37804576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGCTCCCACATGATTG -3'
(R):5'- GAATGCTGTTCACTGGTAGAGG -3'

Sequencing Primer
(F):5'- CTTTGGTTCTGGGGCTTTCATGTATC -3'
(R):5'- AGAGGAATTGGCTGGTATCCATG -3'
Posted On2018-11-06