Incidental Mutation 'R6893:Ppa1'
ID538168
Institutional Source Beutler Lab
Gene Symbol Ppa1
Ensembl Gene ENSMUSG00000020089
Gene Namepyrophosphatase (inorganic) 1
SynonymsPyp, 2010317E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6893 (G1)
Quality Score196.009
Status Validated
Chromosome10
Chromosomal Location61648552-61674168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61672403 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 270 (C270S)
Ref Sequence ENSEMBL: ENSMUSP00000020286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020286]
Predicted Effect probably benign
Transcript: ENSMUST00000020286
AA Change: C270S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020286
Gene: ENSMUSG00000020089
AA Change: C270S

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 46 228 2.3e-60 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the inorganic pyrophosphatase (PPase) family. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Studies of a similar protein in bovine suggested a cytoplasmic localization of this enzyme. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Ppa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Ppa1 APN 10 61665436 missense probably benign 0.12
IGL02489:Ppa1 APN 10 61665444 missense probably damaging 0.99
hotpot UTSW 10 61666970 missense probably damaging 1.00
R0635:Ppa1 UTSW 10 61665440 missense probably benign 0.02
R0635:Ppa1 UTSW 10 61666970 missense probably damaging 1.00
R1925:Ppa1 UTSW 10 61651609 nonsense probably null
R2283:Ppa1 UTSW 10 61661009 nonsense probably null
R2394:Ppa1 UTSW 10 61672384 splice site probably benign
R6180:Ppa1 UTSW 10 61667652 missense probably benign
R6823:Ppa1 UTSW 10 61667603 missense probably damaging 1.00
R6999:Ppa1 UTSW 10 61661017 missense probably damaging 1.00
R7298:Ppa1 UTSW 10 61666912 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATATTGACCTCTTATCAGCTCACAC -3'
(R):5'- ATAAACACGGGTCCTCCAGC -3'

Sequencing Primer
(F):5'- ACACCCTCCATTGTTCCTATAAG -3'
(R):5'- TGTGAGGGGATACATTTCCTAAC -3'
Posted On2018-11-06