Incidental Mutation 'R6893:Specc1'
ID538171
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62132453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 115 (S115R)
Ref Sequence ENSEMBL: ENSMUSP00000144483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202905]
Predicted Effect silent
Transcript: ENSMUST00000049836
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000092415
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000108709
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect silent
Transcript: ENSMUST00000201364
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000201624
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000201671
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000201723
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202178
AA Change: S775R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: S775R

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000202179
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect silent
Transcript: ENSMUST00000202389
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202744
AA Change: S115R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331
AA Change: S115R

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000202905
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GAGGTAACGTGGAGTCTGTC -3'
(R):5'- TCTGATGTAGAGACTTTGGCAAG -3'

Sequencing Primer
(F):5'- TCCTTTTCAGGAGGAAACAGAAG -3'
(R):5'- AAAGTCTATCAGGTGCCC -3'
Posted On2018-11-06