Incidental Mutation 'R6893:Serpina3b'
ID538173
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonymsantitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104127996-104139545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104133026 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 267 (K267E)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: K267E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: K267E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104130777 missense probably benign 0.02
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6673:Serpina3b UTSW 12 104130669 missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104130463 start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104132964 missense probably benign 0.01
R8040:Serpina3b UTSW 12 104131076 missense probably benign 0.00
R8143:Serpina3b UTSW 12 104130534 missense probably benign 0.06
R8360:Serpina3b UTSW 12 104138703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCATCTTTAGCGGAATGG -3'
(R):5'- TCTGATGACACTTTAACCACTACAC -3'

Sequencing Primer
(F):5'- GATGGTGCCTTTTAACTCTGATGAC -3'
(R):5'- TAACCACTACACTAGACATAAGTGAG -3'
Posted On2018-11-06