Mutagenetix > Incidental Mutations

Incidental Mutation 'R6893:Nid2'

538175

Institutional Source

Beutler Lab

Gene Symbol

Nid2

Ensembl Gene

ENSMUSG00000021806

Gene Name

nidogen 2

Synonyms

entactin 2, entactin-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R6893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19751265-19811787 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19789787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 815 (F815I)

Ref Sequence

ENSEMBL: ENSMUSP00000022340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022340]

AlphaFold

O88322

Predicted Effect

probably benign
Transcript: ENSMUST00000022340
AA Change: F815I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: F815I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Blast:NIDO	39	77	3e-11	BLAST
NIDO	108	276	1.12e-72	SMART
low complexity region	421	430	N/A	INTRINSIC
low complexity region	452	470	N/A	INTRINSIC
EGF	510	547	1.84e1	SMART
G2F	548	780	4.36e-143	SMART
EGF	785	823	2.52e-2	SMART
EGF_CA	824	866	1.45e-11	SMART
EGF	874	914	3.15e-3	SMART
EGF_CA	915	953	5.03e-11	SMART
TY	988	1037	8.27e-20	SMART
TY	1068	1116	1.19e-20	SMART
LY	1162	1204	1.15e-5	SMART
LY	1206	1248	8.82e-16	SMART
LY	1249	1293	1.51e-14	SMART
LY	1294	1336	3.56e-11	SMART

Predicted Effect

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.7%
20x: 95.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	T	A	8: 24,878,754	D538V	probably damaging	Het
Akap9	T	C	5: 3,961,709	I804T	probably benign	Het
Amy1	T	C	3: 113,563,632	E186G	probably benign	Het
Best1	A	G	19: 9,997,082	Y33H	probably damaging	Het
Cacna1s	C	A	1: 136,077,693	N405K	probably benign	Het
Casp7	T	C	19: 56,433,309	Y60H	probably damaging	Het
Ccdc61	T	C	7: 18,892,563	N367S	possibly damaging	Het
Cnksr3	A	T	10: 7,135,129		probably null	Het
Col14a1	A	C	15: 55,444,648		probably benign	Het
Cyp3a57	A	T	5: 145,386,974	K424*	probably null	Het
Dpep3	T	C	8: 105,973,842	K411E	probably benign	Het
Ebf2	T	A	14: 67,237,559	V81E	probably benign	Het
Ehbp1	G	T	11: 22,014,945	T1084K	probably damaging	Het
Fastkd2	C	T	1: 63,731,794	A103V	possibly damaging	Het
Gm13762	A	G	2: 88,973,799	F31L	probably benign	Het
Gtf3c2	T	C	5: 31,166,378	K525E	probably benign	Het
Hdac2	A	G	10: 36,997,007	E287G	probably damaging	Het
Ifi207	T	A	1: 173,727,642	T832S	possibly damaging	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Lef1	A	G	3: 131,115,500	D55G	possibly damaging	Het
Lipo2	G	T	19: 33,721,007	Y323*	probably null	Het
Mettl24	C	T	10: 40,737,798	R178C	probably damaging	Het
Nat6	A	G	9: 107,583,026	E40G	probably damaging	Het
Ndrg4	C	A	8: 95,706,601	C66*	probably null	Het
Nemf	A	G	12: 69,352,336	V140A	probably benign	Het
Olfr1076	A	G	2: 86,508,792	E111G	probably damaging	Het
Olfr1459	A	C	19: 13,145,742	S306A	probably benign	Het
Olfr876	A	C	9: 37,804,845	*311C	probably null	Het
Olfr918	A	T	9: 38,673,059	N141K	possibly damaging	Het
Pcdhga3	T	C	18: 37,676,545	S684P	probably benign	Het
Plch1	A	T	3: 63,753,141	C352*	probably null	Het
Plscr2	G	A	9: 92,290,704	V139I	probably benign	Het
Ppa1	T	A	10: 61,672,403	C270S	probably benign	Het
Ryr2	T	A	13: 11,829,654	M399L	possibly damaging	Het
Scn3a	A	G	2: 65,525,754	V212A	possibly damaging	Het
Serpina3b	A	G	12: 104,133,026	K267E	probably benign	Het
Shroom3	A	G	5: 92,942,204	T938A	probably damaging	Het
Specc1	A	C	11: 62,132,453	S115R	probably benign	Het
Stim2	C	T	5: 54,053,445	T74I	probably benign	Het
Sult6b2	T	A	6: 142,804,299	D31V	possibly damaging	Het
Tbc1d24	A	T	17: 24,182,518	W406R	probably damaging	Het
Tmprss11b	A	G	5: 86,663,386		probably null	Het
Trappc9	A	G	15: 72,925,650	Y575H	possibly damaging	Het
Trim63	C	T	4: 134,323,101	T232M	probably damaging	Het
Ttn	A	T	2: 76,767,836	S19578T	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr63	T	C	3: 146,080,429	E366G	probably damaging	Het
Xpo4	T	A	14: 57,582,310	E1139D	probably benign	Het

Other mutations in Nid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01783:Nid2	APN	14	19768677	missense	probably benign
IGL01788:Nid2	APN	14	19807979	missense	probably damaging	1.00
IGL02259:Nid2	APN	14	19768209	critical splice acceptor site	probably null
IGL03084:Nid2	APN	14	19768932	missense	probably benign	0.05
IGL03247:Nid2	APN	14	19779620	missense	probably damaging	1.00
IGL03098:Nid2	UTSW	14	19805938	missense	probably damaging	0.99
PIT4810001:Nid2	UTSW	14	19810090	missense	possibly damaging	0.82
R0173:Nid2	UTSW	14	19802332	splice site	probably benign
R0501:Nid2	UTSW	14	19789668	splice site	probably null
R1117:Nid2	UTSW	14	19763664	critical splice acceptor site	probably null
R1305:Nid2	UTSW	14	19768862	missense	probably benign	0.00
R1572:Nid2	UTSW	14	19805412	missense	probably benign	0.08
R1594:Nid2	UTSW	14	19781261	missense	probably benign	0.03
R1789:Nid2	UTSW	14	19752431	missense	possibly damaging	0.95
R1927:Nid2	UTSW	14	19768276	missense	probably damaging	1.00
R2085:Nid2	UTSW	14	19778043	missense	probably benign	0.12
R2086:Nid2	UTSW	14	19778043	missense	probably benign	0.12
R2100:Nid2	UTSW	14	19778878	nonsense	probably null
R2158:Nid2	UTSW	14	19778043	missense	probably benign	0.12
R2240:Nid2	UTSW	14	19805914	missense	probably damaging	0.99
R2314:Nid2	UTSW	14	19789761	missense	probably benign	0.01
R2863:Nid2	UTSW	14	19768403	missense	possibly damaging	0.92
R3113:Nid2	UTSW	14	19778043	missense	probably benign	0.12
R3545:Nid2	UTSW	14	19763711	missense	probably damaging	1.00
R3548:Nid2	UTSW	14	19763711	missense	probably damaging	1.00
R3801:Nid2	UTSW	14	19809997	missense	probably damaging	1.00
R4618:Nid2	UTSW	14	19808010	missense	probably damaging	0.99
R4798:Nid2	UTSW	14	19789761	missense	probably benign	0.01
R4953:Nid2	UTSW	14	19778078	nonsense	probably null
R5256:Nid2	UTSW	14	19768208	critical splice acceptor site	probably null
R5289:Nid2	UTSW	14	19805311	missense	possibly damaging	0.95
R5302:Nid2	UTSW	14	19779701	missense	probably benign
R5409:Nid2	UTSW	14	19805962	missense	probably damaging	1.00
R5514:Nid2	UTSW	14	19802467	missense	probably damaging	1.00
R6134:Nid2	UTSW	14	19778783	missense	probably damaging	1.00
R6365:Nid2	UTSW	14	19803133	missense	probably damaging	1.00
R6647:Nid2	UTSW	14	19802416	missense	probably benign	0.04
R6758:Nid2	UTSW	14	19802483	missense	probably damaging	1.00
R6882:Nid2	UTSW	14	19789707	missense	probably damaging	1.00
R7045:Nid2	UTSW	14	19779681	missense	possibly damaging	0.94
R7392:Nid2	UTSW	14	19768656	missense	probably benign	0.00
R7477:Nid2	UTSW	14	19805973	missense	probably benign	0.09
R7515:Nid2	UTSW	14	19791567	missense	probably benign	0.06
R7547:Nid2	UTSW	14	19797277	missense	probably benign
R7594:Nid2	UTSW	14	19768723	missense	probably benign	0.00
R7615:Nid2	UTSW	14	19802530	missense	probably damaging	1.00
R7680:Nid2	UTSW	14	19779647	missense	probably damaging	1.00
R8097:Nid2	UTSW	14	19798589	missense	possibly damaging	0.77
R8167:Nid2	UTSW	14	19810063	missense	possibly damaging	0.57
R8292:Nid2	UTSW	14	19768278	missense	probably damaging	0.99
R8766:Nid2	UTSW	14	19752272	missense	probably benign	0.26
R9093:Nid2	UTSW	14	19807941	missense
R9193:Nid2	UTSW	14	19803210	missense	probably damaging	1.00
RF002:Nid2	UTSW	14	19751366	small deletion	probably benign
RF016:Nid2	UTSW	14	19751363	small deletion	probably benign
X0009:Nid2	UTSW	14	19802511	missense	probably damaging	1.00
X0021:Nid2	UTSW	14	19768862	missense	probably benign	0.00
X0026:Nid2	UTSW	14	19778131	missense	probably damaging	0.96
Z1177:Nid2	UTSW	14	19789808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAAGACTCCGTCTCCTTC -3'
(R):5'- GGCAGAAAGACCCAAGTTGC -3'

Sequencing Primer
(F):5'- AAAGACTCCGTCTCCTTCCTTTC -3'
(R):5'- GACCCAAGTTGCAGTTCATCAG -3'

Posted On

2018-11-06