Incidental Mutation 'R6893:Best1'
ID538183
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Namebestrophin 1
Synonymsbest macular dystrophy, mBest1, Vmd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location9985174-10001633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9997082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 33 (Y33H)
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117346] [ENSMUST00000121418]
Predicted Effect probably damaging
Transcript: ENSMUST00000117346
AA Change: Y33H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418
AA Change: Y33H

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121418
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 129 4.3e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9986735 missense probably benign 0.22
IGL02129:Best1 APN 19 9992921 missense probably benign
IGL02310:Best1 APN 19 9989152 missense probably benign 0.00
IGL02470:Best1 APN 19 9992976 missense probably benign 0.43
IGL02505:Best1 APN 19 9989150 missense probably damaging 1.00
R0366:Best1 UTSW 19 9992053 splice site probably null
R1476:Best1 UTSW 19 9990489 nonsense probably null
R1674:Best1 UTSW 19 9993226 critical splice donor site probably null
R2091:Best1 UTSW 19 9992079 missense probably benign 0.27
R2516:Best1 UTSW 19 9993311 nonsense probably null
R2866:Best1 UTSW 19 9986221 missense probably benign
R4693:Best1 UTSW 19 9997135 missense probably damaging 1.00
R4851:Best1 UTSW 19 9991698 missense probably damaging 1.00
R4895:Best1 UTSW 19 9992771 missense probably benign 0.00
R5633:Best1 UTSW 19 9992103 missense probably benign 0.29
R5700:Best1 UTSW 19 9997199 unclassified probably benign
R5837:Best1 UTSW 19 9989119 splice site probably null
R7021:Best1 UTSW 19 9986779 missense probably benign
R7220:Best1 UTSW 19 9992115 missense probably benign 0.31
R7267:Best1 UTSW 19 9986813 missense probably benign 0.00
R7284:Best1 UTSW 19 9986373 critical splice acceptor site probably null
R7489:Best1 UTSW 19 9997046 missense possibly damaging 0.68
R7568:Best1 UTSW 19 9989275 critical splice acceptor site probably null
R7798:Best1 UTSW 19 9991671 missense probably damaging 1.00
R8192:Best1 UTSW 19 9986300 missense possibly damaging 0.52
X0065:Best1 UTSW 19 9986975 missense probably benign 0.03
Z1177:Best1 UTSW 19 9993239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAACATCAGACCCTC -3'
(R):5'- TGCCTTCTGTGTCTCAGGCTAG -3'

Sequencing Primer
(F):5'- TGGAACATCAGACCCTCTCCTG -3'
(R):5'- AGATCAGAACCTAGTCTTTGACTCC -3'
Posted On2018-11-06