Incidental Mutation 'R6894:Dpp10'
ID538189
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Namedipeptidylpeptidase 10
Synonyms6430601K09Rik, DPRP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6894 (G1)
Quality Score220.009
Status Not validated
Chromosome1
Chromosomal Location123321471-124045559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123336864 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 743 (I743N)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: I732N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: I732N

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: I743N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: I743N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCACACATTCATGCAC -3'
(R):5'- TGGCACTTGGCAGATCTCTAG -3'

Sequencing Primer
(F):5'- GTATGATACTTCCTTGCCACAGAGG -3'
(R):5'- GGCAGATCTCTAGTTAGAATCACCAG -3'
Posted On2018-11-06