Incidental Mutation 'R6894:Grin1'
ID538191
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25295817 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 876 (V876E)
Ref Sequence ENSEMBL: ENSMUSP00000109956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000028337] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably damaging
Transcript: ENSMUST00000028335
AA Change: V855E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959
AA Change: V855E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000028337
SMART Domains Protein: ENSMUSP00000028337
Gene: ENSMUSG00000026961

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 42 75 1.86e0 SMART
LRR 72 93 7.57e0 SMART
LRR 95 117 6.96e0 SMART
LRR_TYP 118 141 1e-5 SMART
LRR 142 165 6.22e0 SMART
LRR 166 189 2.86e-1 SMART
LRRCT 201 254 3.01e-5 SMART
transmembrane domain 267 289 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114307
AA Change: V855E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959
AA Change: V855E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114308
AA Change: V876E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959
AA Change: V876E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114310
AA Change: V876E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959
AA Change: V876E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114312
AA Change: V855E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959
AA Change: V855E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114314
AA Change: V855E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959
AA Change: V855E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114317
AA Change: V876E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959
AA Change: V876E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114318
AA Change: V876E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959
AA Change: V876E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0038:Grin1 UTSW 2 25297459 missense probably null 0.82
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1550:Grin1 UTSW 2 25305131 missense probably benign 0.01
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2057:Grin1 UTSW 2 25316820 missense probably damaging 1.00
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3422:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5125:Grin1 UTSW 2 25296827 intron probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 splice site probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
R7544:Grin1 UTSW 2 25305074 missense probably benign 0.05
R7693:Grin1 UTSW 2 25318667 missense possibly damaging 0.93
R7872:Grin1 UTSW 2 25298190 missense probably benign 0.01
R7986:Grin1 UTSW 2 25295829 missense probably damaging 1.00
R8350:Grin1 UTSW 2 25298311 missense probably damaging 1.00
R8795:Grin1 UTSW 2 25297456 missense probably damaging 0.99
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Z1176:Grin1 UTSW 2 25297907 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTGGGAACACTCACCACTG -3'
(R):5'- TTTTGAGAACATGGCAGGTGC -3'

Sequencing Primer
(F):5'- ACTCACCACTGCCCCTGG -3'
(R):5'- CCGTGATCCTGGGATGGATTCTC -3'
Posted On2018-11-06