Incidental Mutation 'R6894:Olfr1231'
ID538194
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89303493 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 33 (L33S)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099786
AA Change: L33S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: L33S

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216144
AA Change: L33S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
PIT4305001:Olfr1231 UTSW 2 89303383 missense probably benign 0.05
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0974:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4208:Olfr1231 UTSW 2 89302926 missense probably damaging 1.00
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4693:Olfr1231 UTSW 2 89303277 missense probably benign 0.07
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R8019:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTCAGACATCCAGCCAAGG -3'
(R):5'- CCCTGTTGGTATAGTGTGAACATC -3'

Sequencing Primer
(F):5'- GTCAGACATCCAGCCAAGGATATTG -3'
(R):5'- GTGTGAACATCAGACTACATGC -3'
Posted On2018-11-06