Incidental Mutation 'R6894:Zfp382'
ID 538215
Institutional Source Beutler Lab
Gene Symbol Zfp382
Ensembl Gene ENSMUSG00000074220
Gene Name zinc finger protein 382
Synonyms 5930415A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R6894 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30121942-30134950 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30125836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 38 (S38A)
Ref Sequence ENSEMBL: ENSMUSP00000096196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098596] [ENSMUST00000153792]
AlphaFold B2RXC5
Predicted Effect probably benign
Transcript: ENSMUST00000098596
AA Change: S38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096196
Gene: ENSMUSG00000074220
AA Change: S38A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 42 102 3.36e-39 SMART
ZnF_C2H2 325 347 1.84e-4 SMART
ZnF_C2H2 353 375 7.26e-3 SMART
ZnF_C2H2 381 403 2.71e-2 SMART
ZnF_C2H2 409 431 4.47e-3 SMART
ZnF_C2H2 437 459 2.12e-4 SMART
ZnF_C2H2 465 487 3.95e-4 SMART
ZnF_C2H2 493 515 1.12e-3 SMART
ZnF_C2H2 521 543 2.57e-3 SMART
ZnF_C2H2 549 571 3.63e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153792
AA Change: S38A
SMART Domains Protein: ENSMUSP00000123508
Gene: ENSMUSG00000074220
AA Change: S38A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Other mutations in Zfp382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Zfp382 APN 7 30133737 missense probably benign 0.00
IGL03116:Zfp382 APN 7 30134189 missense probably damaging 1.00
R1051:Zfp382 UTSW 7 30134010 missense probably damaging 1.00
R1371:Zfp382 UTSW 7 30133689 missense probably benign 0.36
R1513:Zfp382 UTSW 7 30133296 missense probably benign 0.04
R1525:Zfp382 UTSW 7 30133719 missense probably damaging 0.99
R2416:Zfp382 UTSW 7 30134403 missense probably damaging 1.00
R2432:Zfp382 UTSW 7 30133749 missense probably benign
R4864:Zfp382 UTSW 7 30133460 missense possibly damaging 0.58
R4956:Zfp382 UTSW 7 30131554 missense probably benign 0.00
R5734:Zfp382 UTSW 7 30134430 missense probably damaging 1.00
R5796:Zfp382 UTSW 7 30133349 missense probably damaging 1.00
R6062:Zfp382 UTSW 7 30133590 missense probably damaging 1.00
R6300:Zfp382 UTSW 7 30131629 splice site probably null
R6312:Zfp382 UTSW 7 30134538 missense probably damaging 0.99
R7764:Zfp382 UTSW 7 30133275 missense probably benign 0.04
R7771:Zfp382 UTSW 7 30133335 missense probably damaging 1.00
R7794:Zfp382 UTSW 7 30131610 missense possibly damaging 0.84
R8207:Zfp382 UTSW 7 30134415 missense possibly damaging 0.74
R8267:Zfp382 UTSW 7 30134504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGAAATGCATGCAGATGTC -3'
(R):5'- TACCAGGACAGCAACCAGTG -3'

Sequencing Primer
(F):5'- AGATGTCCCCGAGTTATTCTGAGAC -3'
(R):5'- GCAGGTGAGCCATGTACAG -3'
Posted On 2018-11-06