Incidental Mutation 'R6894:Stk33'
ID538218
Institutional Source Beutler Lab
Gene Symbol Stk33
Ensembl Gene ENSMUSG00000031027
Gene Nameserine/threonine kinase 33
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location109279223-109439081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109336062 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 174 (E174D)
Ref Sequence ENSEMBL: ENSMUSP00000112515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090414] [ENSMUST00000106745] [ENSMUST00000121378] [ENSMUST00000121748] [ENSMUST00000141210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090414
AA Change: E174D

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087897
Gene: ENSMUSG00000031027
AA Change: E174D

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106745
AA Change: E174D

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102356
Gene: ENSMUSG00000031027
AA Change: E174D

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121378
AA Change: E51D

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112560
Gene: ENSMUSG00000031027
AA Change: E51D

DomainStartEndE-ValueType
S_TKc 2 254 1.01e-83 SMART
low complexity region 276 291 N/A INTRINSIC
low complexity region 322 344 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121748
AA Change: E174D

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112515
Gene: ENSMUSG00000031027
AA Change: E174D

DomainStartEndE-ValueType
S_TKc 111 377 4.8e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Stk33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Stk33 APN 7 109329568 missense probably benign 0.02
IGL01467:Stk33 APN 7 109329589 missense probably damaging 0.99
IGL01558:Stk33 APN 7 109341284 intron probably benign
IGL01775:Stk33 APN 7 109312367 missense possibly damaging 0.92
R0052:Stk33 UTSW 7 109279669 missense possibly damaging 0.46
R0336:Stk33 UTSW 7 109331474 missense probably benign 0.01
R0394:Stk33 UTSW 7 109341489 missense probably benign
R0579:Stk33 UTSW 7 109325697 missense probably damaging 0.99
R0727:Stk33 UTSW 7 109321518 missense probably damaging 0.96
R1363:Stk33 UTSW 7 109279821 missense probably benign 0.06
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R2153:Stk33 UTSW 7 109341320 missense probably benign 0.01
R4366:Stk33 UTSW 7 109279795 missense probably benign 0.06
R4896:Stk33 UTSW 7 109327595 missense probably damaging 1.00
R4994:Stk33 UTSW 7 109340398 missense probably benign 0.08
R5283:Stk33 UTSW 7 109336127 missense possibly damaging 0.69
R6339:Stk33 UTSW 7 109321465 missense probably benign 0.03
R6547:Stk33 UTSW 7 109320835 missense possibly damaging 0.73
R6717:Stk33 UTSW 7 109327616 missense possibly damaging 0.51
Z1176:Stk33 UTSW 7 109336059 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATGTGCCACCCAGAACATG -3'
(R):5'- CACTATTCAAAACTGTAGGAAAGGG -3'

Sequencing Primer
(F):5'- GTGCCACCCAGAACATGTAACTAAAG -3'
(R):5'- TAGGCTGGAAGTTCTGCA -3'
Posted On2018-11-06