Mutagenetix > Incidental Mutation

Incidental Mutation 'R6894:Muc16'

538227

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

044988-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R6894 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18495576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 8460 (V8460A)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034653
AA Change: V240A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: V240A

Domain	Start	End	E-Value	Type
Pfam:SEA	71	174	9.6e-30	PFAM
transmembrane domain	205	227	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208663
AA Change: V8460A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,930,662	A199T	probably damaging	Het
2410089E03Rik	T	C	15: 8,187,368	L690P	probably damaging	Het
4921509C19Rik	C	A	2: 151,473,307	L150F	probably damaging	Het
4930449I24Rik	G	A	5: 146,504,732	E230K	possibly damaging	Het
4930449I24Rik	A	T	5: 146,504,733	E230V	probably benign	Het
9430038I01Rik	A	G	7: 137,387,388	C93R	possibly damaging	Het
Apobec1	T	C	6: 122,591,242		probably benign	Het
Arl4c	T	A	1: 88,701,375	D97V	probably damaging	Het
Ash1l	A	G	3: 88,982,991	T726A	probably benign	Het
Asz1	A	C	6: 18,055,521	F359V	probably damaging	Het
Atr	T	A	9: 95,927,197	L1970H	probably damaging	Het
Baz2a	G	T	10: 128,123,581	A1322S	possibly damaging	Het
Cd209e	T	A	8: 3,853,569	I37F	possibly damaging	Het
Cd209f	T	C	8: 4,105,477	K37R	probably benign	Het
Cd5	G	C	19: 10,738,839	S3C	possibly damaging	Het
Clec16a	A	T	16: 10,644,854	I260F	probably damaging	Het
Cltc	A	T	11: 86,712,602	Y799*	probably null	Het
Csde1	G	A	3: 103,044,656	V258I	possibly damaging	Het
Dennd5a	G	T	7: 109,901,118	H909Q	probably damaging	Het
Dnah12	A	G	14: 26,735,749	D890G	probably damaging	Het
Dnah2	A	T	11: 69,484,260	M1379K	probably benign	Het
Dpp10	A	T	1: 123,336,864	I743N	probably damaging	Het
Dpp9	T	A	17: 56,188,321	T815S	probably damaging	Het
Ears2	T	C	7: 122,048,224	N279S	probably damaging	Het
Ect2l	A	G	10: 18,169,380		probably null	Het
Eomes	C	G	9: 118,481,285	P288A	probably damaging	Het
Fam205a1	G	A	4: 42,850,291	P622S	probably benign	Het
Fat3	T	C	9: 15,997,776	D2310G	probably damaging	Het
Fignl2	T	C	15: 101,053,973	T143A	probably benign	Het
Gdf9	A	G	11: 53,436,819	K201E	possibly damaging	Het
Gfra3	C	T	18: 34,695,657	R228Q	probably damaging	Het
Grin1	A	T	2: 25,295,817	V876E	probably damaging	Het
Igkv12-41	A	C	6: 69,858,651	V39G	probably damaging	Het
Kat7	A	T	11: 95,284,084	M367K	possibly damaging	Het
Ly6d	T	C	15: 74,762,805	K33E	possibly damaging	Het
Lztfl1	T	C	9: 123,700,933	N273S	possibly damaging	Het
Macf1	T	A	4: 123,483,687	I1485F	possibly damaging	Het
March10	G	T	11: 105,396,961	L172I	possibly damaging	Het
Mdn1	T	G	4: 32,748,614	S4220A	possibly damaging	Het
Myh14	A	G	7: 44,633,512	F769L	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk4	A	G	13: 32,722,015	L395P	probably damaging	Het
Nat8f6	A	T	6: 85,808,522	L215*	probably null	Het
Nell2	T	C	15: 95,346,887	D443G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,616	K197R	probably benign	Het
Nt5c3	A	T	6: 56,882,973	L293*	probably null	Het
Ntrk1	A	T	3: 87,782,802	V429D	probably damaging	Het
Obscn	A	G	11: 59,132,682	V623A	probably benign	Het
Olfr1054	A	T	2: 86,332,951	I135N	probably damaging	Het
Olfr1231	A	G	2: 89,303,493	L33S	probably damaging	Het
Olfr1394	T	C	11: 49,160,359	F115S	probably benign	Het
Olfr203	A	G	16: 59,303,779	T209A	probably damaging	Het
Olfr467	C	T	7: 107,815,064	T160I	probably benign	Het
Olfr821	T	C	10: 130,034,309	S228P	probably damaging	Het
Pate3	T	A	9: 35,646,673	D33V	probably damaging	Het
Pcnx	T	A	12: 81,987,973	I1843N	probably damaging	Het
Pla2g4f	A	T	2: 120,303,596	I503N	probably benign	Het
Prkg1	C	A	19: 30,624,774	E361*	probably null	Het
Proca1	A	G	11: 78,194,787		probably benign	Het
Prss38	G	T	11: 59,373,024	H287Q	probably benign	Het
Ptpdc1	T	C	13: 48,590,638	E169G	probably benign	Het
Ptpn21	T	C	12: 98,715,181	S65G	probably damaging	Het
Rfx6	A	T	10: 51,716,039	H177L	probably damaging	Het
Slc20a2	G	A	8: 22,560,593	G276D	possibly damaging	Het
Spag6l	A	T	16: 16,783,938	L159I	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Stk33	T	A	7: 109,336,062	E174D	possibly damaging	Het
Stxbp5	A	T	10: 9,784,361	V730E	probably benign	Het
Tmprss15	A	T	16: 79,075,814	L168*	probably null	Het
Tnrc18	A	T	5: 142,760,049	M1323K	unknown	Het
Tpr	T	C	1: 150,436,847	V1932A	probably benign	Het
Trak2	A	G	1: 58,911,733	S432P	probably damaging	Het
Ttn	A	T	2: 76,908,190	F4002I	probably benign	Het
Txndc11	G	A	16: 11,088,145	T507I	probably damaging	Het
Usp12	G	A	5: 146,754,539	T135I	possibly damaging	Het
Vit	T	A	17: 78,626,758	Y596*	probably null	Het
Vmn1r32	A	T	6: 66,553,361	Y144N	possibly damaging	Het
Vmn2r80	G	T	10: 79,169,604	L358F	probably benign	Het
Zfp382	T	G	7: 30,125,836	S38A	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
Brimming	UTSW	9	18592680	missense	probably damaging	0.99
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
R9490:Muc16	UTSW	9	18656853	nonsense	probably null
R9519:Muc16	UTSW	9	18586920	missense	probably benign	0.03
R9524:Muc16	UTSW	9	18586018	missense	probably benign	0.03
R9556:Muc16	UTSW	9	18658638	missense	unknown
R9583:Muc16	UTSW	9	18638677	missense	probably benign	0.01
R9600:Muc16	UTSW	9	18655851	missense	unknown
R9638:Muc16	UTSW	9	18639330	missense	probably benign	0.12
R9650:Muc16	UTSW	9	18642466	missense	unknown
R9652:Muc16	UTSW	9	18586882	missense	probably benign	0.03
R9666:Muc16	UTSW	9	18655989	missense	unknown
R9682:Muc16	UTSW	9	18642578	missense	unknown
R9765:Muc16	UTSW	9	18637198	missense	probably benign	0.16
R9766:Muc16	UTSW	9	18636857	missense	probably benign	0.08
R9766:Muc16	UTSW	9	18641087	missense	probably benign	0.01
R9776:Muc16	UTSW	9	18659379	missense	unknown
R9782:Muc16	UTSW	9	18636770	missense	possibly damaging	0.64
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATTTCTCAGTCCCCAGGG -3'
(R):5'- AGGTTACTGGTGAATTACATGCA -3'

Sequencing Primer
(F):5'- GACGTGCACAGGGATCAAGTC -3'
(R):5'- CAGGAAGAAGGGGTTTTTCTGAAC -3'

Posted On

2018-11-06