Incidental Mutation 'R6894:Kat7'
ID538245
Institutional Source Beutler Lab
Gene Symbol Kat7
Ensembl Gene ENSMUSG00000038909
Gene NameK(lysine) acetyltransferase 7
SynonymsMyst2, Hboa, Hbo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95274259-95310246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95284084 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 367 (M367K)
Ref Sequence ENSEMBL: ENSMUSP00000103362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072621] [ENSMUST00000092766] [ENSMUST00000103159] [ENSMUST00000107733] [ENSMUST00000107734]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072621
AA Change: M339K

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072416
Gene: ENSMUSG00000038909
AA Change: M339K

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 184 214 3.2e-17 PFAM
ZnF_C2H2 338 364 1.86e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092766
AA Change: M369K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090441
Gene: ENSMUSG00000038909
AA Change: M369K

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 186 214 1.2e-16 PFAM
ZnF_C2H2 368 394 1.86e1 SMART
Pfam:MOZ_SAS 395 573 7.9e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103159
AA Change: M278K

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099448
Gene: ENSMUSG00000038909
AA Change: M278K

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
Pfam:zf-C2HC 123 153 2.8e-17 PFAM
ZnF_C2H2 277 303 1.86e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107733
AA Change: M337K

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103361
Gene: ENSMUSG00000038909
AA Change: M337K

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.3e-17 PFAM
ZnF_C2H2 336 362 1.86e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107734
AA Change: M367K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103362
Gene: ENSMUSG00000038909
AA Change: M367K

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.5e-17 PFAM
ZnF_C2H2 366 392 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138671
SMART Domains Protein: ENSMUSP00000121772
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
Pfam:MOZ_SAS 1 148 1.7e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the multimeric HBO1 complex, which possesses histone H4-specific acetyltransferase activity. This activity is required for functional replication origins and is involved in transcriptional activation of some genes. In both cases, the acetylation of histone H4 helps unfold chromatin so that the DNA can be accessed and replicated or transcribed. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic growth arrest, incomplete embryo turning, disorganized yolk sac vascular plexus, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Kat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Kat7 APN 11 95306133 missense probably benign 0.01
IGL03287:Kat7 APN 11 95300109 missense probably damaging 1.00
R0047:Kat7 UTSW 11 95300208 missense probably benign 0.07
R0578:Kat7 UTSW 11 95291524 missense probably benign 0.00
R1739:Kat7 UTSW 11 95276547 missense possibly damaging 0.85
R2038:Kat7 UTSW 11 95300102 missense probably benign 0.14
R2115:Kat7 UTSW 11 95303294 missense probably benign 0.10
R2214:Kat7 UTSW 11 95275805 missense probably damaging 0.99
R2355:Kat7 UTSW 11 95291581 missense probably benign
R3425:Kat7 UTSW 11 95303165 missense probably damaging 1.00
R3775:Kat7 UTSW 11 95291531 missense probably benign 0.00
R3811:Kat7 UTSW 11 95291615 splice site probably benign
R4066:Kat7 UTSW 11 95284141 missense possibly damaging 0.93
R4169:Kat7 UTSW 11 95280472 missense probably damaging 0.99
R4657:Kat7 UTSW 11 95277598 missense probably damaging 1.00
R4814:Kat7 UTSW 11 95303123 splice site probably benign
R5186:Kat7 UTSW 11 95286416 missense probably benign 0.00
R6015:Kat7 UTSW 11 95284034 missense probably damaging 1.00
R6820:Kat7 UTSW 11 95284139 missense probably damaging 1.00
R7192:Kat7 UTSW 11 95275830 missense probably benign 0.00
R7217:Kat7 UTSW 11 95291564 missense possibly damaging 0.79
R7728:Kat7 UTSW 11 95300081 missense probably benign 0.25
R7999:Kat7 UTSW 11 95284109 missense probably damaging 1.00
R8230:Kat7 UTSW 11 95277589 missense probably damaging 1.00
R8747:Kat7 UTSW 11 95294566 missense probably damaging 1.00
R8929:Kat7 UTSW 11 95306156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGTCTCCACCCGACTGCTG -3'
(R):5'- TATAGCTTAGTTGCTGGCCTC -3'

Sequencing Primer
(F):5'- CGACTGCTGTGGACACTTG -3'
(R):5'- GTGAGCTATAGACACATGCATGCTTG -3'
Posted On2018-11-06