Incidental Mutation 'R6894:Pcnx'
ID538247
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81987973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1843 (I1843N)
Ref Sequence ENSEMBL: ENSMUSP00000021567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021567
AA Change: I1843N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: I1843N

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000221721
AA Change: I1837N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 splice site probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
R8078:Pcnx UTSW 12 81975280 missense
R8093:Pcnx UTSW 12 81918819 nonsense probably null
R8104:Pcnx UTSW 12 81983611 nonsense probably null
R8108:Pcnx UTSW 12 81918819 nonsense probably null
R8109:Pcnx UTSW 12 81918819 nonsense probably null
R8131:Pcnx UTSW 12 81918518 missense possibly damaging 0.80
R8136:Pcnx UTSW 12 81918006 missense probably benign
R8153:Pcnx UTSW 12 81918819 nonsense probably null
R8156:Pcnx UTSW 12 81918819 nonsense probably null
R8202:Pcnx UTSW 12 81895047 missense probably benign 0.00
R8362:Pcnx UTSW 12 81967056 missense
R8515:Pcnx UTSW 12 81962716 missense possibly damaging 0.83
R8803:Pcnx UTSW 12 81993151 missense possibly damaging 0.85
R8820:Pcnx UTSW 12 81973248 missense
R8828:Pcnx UTSW 12 81995823 missense probably damaging 1.00
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- TGGATGACTGATGCAGAGC -3'
(R):5'- TTTGCTGCTGACATCTAGATCATG -3'

Sequencing Primer
(F):5'- CAGACATGAGGCTGAGTGTC -3'
(R):5'- GTTCAGATGAGAGCCTTTCCAAAG -3'
Posted On2018-11-06