Incidental Mutation 'R6894:Clec16a'
ID538257
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10644854 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 260 (I260F)
Ref Sequence ENSEMBL: ENSMUSP00000111489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably damaging
Transcript: ENSMUST00000038145
AA Change: I695F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663
AA Change: I695F

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066345
AA Change: I681F

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: I681F

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115823
AA Change: I260F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663
AA Change: I260F

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115824
AA Change: I681F

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: I681F

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115827
AA Change: I695F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663
AA Change: I695F

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155633
AA Change: I679F

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: I679F

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Baz2a G T 10: 128,123,581 A1322S possibly damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 splice site probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
R8207:Clec16a UTSW 16 10627448 missense probably benign 0.00
R8207:Clec16a UTSW 16 10694710 missense probably damaging 1.00
R8423:Clec16a UTSW 16 10576663 missense probably benign 0.04
R8447:Clec16a UTSW 16 10741623 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTCACCATGCAATGCCTTC -3'
(R):5'- AGGCCAGTGCTGTTCTCATG -3'

Sequencing Primer
(F):5'- ATGCAATGCCTTCATGCAGG -3'
(R):5'- GTTCTCATGTCAGTGCGGCC -3'
Posted On2018-11-06