Mutagenetix > Incidental Mutation

Incidental Mutation 'R6894:Prkg1'

538266

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

R6894 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 30624774 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 361 (E361*)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably null
Transcript: ENSMUST00000065067
AA Change: E346*

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: E346*

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000073581
AA Change: E361*

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: E361*

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,930,662	A199T	probably damaging	Het
2410089E03Rik	T	C	15: 8,187,368	L690P	probably damaging	Het
4921509C19Rik	C	A	2: 151,473,307	L150F	probably damaging	Het
4930449I24Rik	G	A	5: 146,504,732	E230K	possibly damaging	Het
4930449I24Rik	A	T	5: 146,504,733	E230V	probably benign	Het
9430038I01Rik	A	G	7: 137,387,388	C93R	possibly damaging	Het
Apobec1	T	C	6: 122,591,242		probably benign	Het
Arl4c	T	A	1: 88,701,375	D97V	probably damaging	Het
Ash1l	A	G	3: 88,982,991	T726A	probably benign	Het
Asz1	A	C	6: 18,055,521	F359V	probably damaging	Het
Atr	T	A	9: 95,927,197	L1970H	probably damaging	Het
Baz2a	G	T	10: 128,123,581	A1322S	possibly damaging	Het
Cd209e	T	A	8: 3,853,569	I37F	possibly damaging	Het
Cd209f	T	C	8: 4,105,477	K37R	probably benign	Het
Cd5	G	C	19: 10,738,839	S3C	possibly damaging	Het
Clec16a	A	T	16: 10,644,854	I260F	probably damaging	Het
Cltc	A	T	11: 86,712,602	Y799*	probably null	Het
Csde1	G	A	3: 103,044,656	V258I	possibly damaging	Het
Dennd5a	G	T	7: 109,901,118	H909Q	probably damaging	Het
Dnah12	A	G	14: 26,735,749	D890G	probably damaging	Het
Dnah2	A	T	11: 69,484,260	M1379K	probably benign	Het
Dpp10	A	T	1: 123,336,864	I743N	probably damaging	Het
Dpp9	T	A	17: 56,188,321	T815S	probably damaging	Het
Ears2	T	C	7: 122,048,224	N279S	probably damaging	Het
Ect2l	A	G	10: 18,169,380		probably null	Het
Eomes	C	G	9: 118,481,285	P288A	probably damaging	Het
Fam205a1	G	A	4: 42,850,291	P622S	probably benign	Het
Fat3	T	C	9: 15,997,776	D2310G	probably damaging	Het
Fignl2	T	C	15: 101,053,973	T143A	probably benign	Het
Gdf9	A	G	11: 53,436,819	K201E	possibly damaging	Het
Gfra3	C	T	18: 34,695,657	R228Q	probably damaging	Het
Grin1	A	T	2: 25,295,817	V876E	probably damaging	Het
Igkv12-41	A	C	6: 69,858,651	V39G	probably damaging	Het
Kat7	A	T	11: 95,284,084	M367K	possibly damaging	Het
Ly6d	T	C	15: 74,762,805	K33E	possibly damaging	Het
Lztfl1	T	C	9: 123,700,933	N273S	possibly damaging	Het
Macf1	T	A	4: 123,483,687	I1485F	possibly damaging	Het
March10	G	T	11: 105,396,961	L172I	possibly damaging	Het
Mdn1	T	G	4: 32,748,614	S4220A	possibly damaging	Het
Muc16	A	G	9: 18,495,576	V8460A	possibly damaging	Het
Myh14	A	G	7: 44,633,512	F769L	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Mylk4	A	G	13: 32,722,015	L395P	probably damaging	Het
Nat8f6	A	T	6: 85,808,522	L215*	probably null	Het
Nell2	T	C	15: 95,346,887	D443G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,616	K197R	probably benign	Het
Nt5c3	A	T	6: 56,882,973	L293*	probably null	Het
Ntrk1	A	T	3: 87,782,802	V429D	probably damaging	Het
Obscn	A	G	11: 59,132,682	V623A	probably benign	Het
Olfr1054	A	T	2: 86,332,951	I135N	probably damaging	Het
Olfr1231	A	G	2: 89,303,493	L33S	probably damaging	Het
Olfr1394	T	C	11: 49,160,359	F115S	probably benign	Het
Olfr203	A	G	16: 59,303,779	T209A	probably damaging	Het
Olfr467	C	T	7: 107,815,064	T160I	probably benign	Het
Olfr821	T	C	10: 130,034,309	S228P	probably damaging	Het
Pate3	T	A	9: 35,646,673	D33V	probably damaging	Het
Pcnx	T	A	12: 81,987,973	I1843N	probably damaging	Het
Pla2g4f	A	T	2: 120,303,596	I503N	probably benign	Het
Proca1	A	G	11: 78,194,787		probably benign	Het
Prss38	G	T	11: 59,373,024	H287Q	probably benign	Het
Ptpdc1	T	C	13: 48,590,638	E169G	probably benign	Het
Ptpn21	T	C	12: 98,715,181	S65G	probably damaging	Het
Rfx6	A	T	10: 51,716,039	H177L	probably damaging	Het
Slc20a2	G	A	8: 22,560,593	G276D	possibly damaging	Het
Spag6l	A	T	16: 16,783,938	L159I	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Stk33	T	A	7: 109,336,062	E174D	possibly damaging	Het
Stxbp5	A	T	10: 9,784,361	V730E	probably benign	Het
Tmprss15	A	T	16: 79,075,814	L168*	probably null	Het
Tnrc18	A	T	5: 142,760,049	M1323K	unknown	Het
Tpr	T	C	1: 150,436,847	V1932A	probably benign	Het
Trak2	A	G	1: 58,911,733	S432P	probably damaging	Het
Ttn	A	T	2: 76,908,190	F4002I	probably benign	Het
Txndc11	G	A	16: 11,088,145	T507I	probably damaging	Het
Usp12	G	A	5: 146,754,539	T135I	possibly damaging	Het
Vit	T	A	17: 78,626,758	Y596*	probably null	Het
Vmn1r32	A	T	6: 66,553,361	Y144N	possibly damaging	Het
Vmn2r80	G	T	10: 79,169,604	L358F	probably benign	Het
Zfp382	T	G	7: 30,125,836	S38A	probably benign	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACAGTCTCAGACATGCCTGC -3'
(R):5'- CTGGGACCAAAAGATTATGTGTG -3'

Sequencing Primer
(F):5'- CTGCTTCTGATTAGAGCAATGATAG -3'
(R):5'- TATGTGTGTGAGAAAACGCAGATTC -3'

Posted On

2018-11-06