Incidental Mutation 'R6895:Jak1'
ID538276
Institutional Source Beutler Lab
Gene Symbol Jak1
Ensembl Gene ENSMUSG00000028530
Gene NameJanus kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101152367-101265282 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 101154537 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038463] [ENSMUST00000102781]
Predicted Effect probably benign
Transcript: ENSMUST00000038463
SMART Domains Protein: ENSMUSP00000043142
Gene: ENSMUSG00000035275

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102781
SMART Domains Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530

DomainStartEndE-ValueType
B41 32 286 2.45e-58 SMART
Blast:B41 291 420 4e-51 BLAST
SH2 437 531 1.85e-13 SMART
STYKc 582 844 6.72e-14 SMART
TyrKc 874 1148 9.01e-122 SMART
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Jak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Jak1 APN 4 101154629 missense probably damaging 1.00
IGL00990:Jak1 APN 4 101171357 missense probably damaging 1.00
IGL01341:Jak1 APN 4 101175093 missense probably damaging 0.98
IGL02102:Jak1 APN 4 101159086 missense probably benign 0.11
IGL02720:Jak1 APN 4 101164450 splice site probably benign
IGL03301:Jak1 APN 4 101175173 missense probably damaging 1.00
Back UTSW 4 101174211 critical splice acceptor site probably null
Behind UTSW 4 101154537 critical splice donor site probably null
BB006:Jak1 UTSW 4 101154645 missense probably damaging 1.00
BB016:Jak1 UTSW 4 101154645 missense probably damaging 1.00
PIT4377001:Jak1 UTSW 4 101179551 missense probably benign 0.19
R0308:Jak1 UTSW 4 101154535 splice site probably null
R0544:Jak1 UTSW 4 101191625 missense probably benign
R1212:Jak1 UTSW 4 101189094 missense probably damaging 1.00
R1519:Jak1 UTSW 4 101162922 missense probably damaging 0.99
R1627:Jak1 UTSW 4 101191624 splice site probably null
R1760:Jak1 UTSW 4 101162929 missense probably benign 0.04
R2116:Jak1 UTSW 4 101179675 missense probably damaging 0.98
R2980:Jak1 UTSW 4 101179781 missense probably damaging 0.99
R3738:Jak1 UTSW 4 101191468 unclassified probably benign
R3779:Jak1 UTSW 4 101156490 missense probably benign 0.40
R4172:Jak1 UTSW 4 101159132 missense probably benign 0.08
R4505:Jak1 UTSW 4 101154603 missense probably benign
R4602:Jak1 UTSW 4 101179594 missense possibly damaging 0.83
R4755:Jak1 UTSW 4 101174157 missense probably damaging 1.00
R4836:Jak1 UTSW 4 101155066 missense probably damaging 0.97
R4908:Jak1 UTSW 4 101179714 missense probably damaging 1.00
R5116:Jak1 UTSW 4 101155113 missense probably benign
R6190:Jak1 UTSW 4 101175128 missense probably damaging 1.00
R6339:Jak1 UTSW 4 101161926 missense probably damaging 0.99
R6500:Jak1 UTSW 4 101181933 missense probably benign 0.43
R6551:Jak1 UTSW 4 101193843 start gained probably benign
R7163:Jak1 UTSW 4 101175188 missense probably damaging 1.00
R7204:Jak1 UTSW 4 101175135 missense probably benign 0.02
R7361:Jak1 UTSW 4 101184339 missense possibly damaging 0.86
R7408:Jak1 UTSW 4 101175182 missense probably damaging 0.96
R7513:Jak1 UTSW 4 101191651 missense probably damaging 0.96
R7617:Jak1 UTSW 4 101174211 critical splice acceptor site probably null
R7779:Jak1 UTSW 4 101160142 missense probably benign
R7929:Jak1 UTSW 4 101154645 missense probably damaging 1.00
R8282:Jak1 UTSW 4 101179541 nonsense probably null
Z1176:Jak1 UTSW 4 101163681 missense probably damaging 1.00
Z1176:Jak1 UTSW 4 101163722 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGGAGGGATTTCTCTCATGTC -3'
(R):5'- TGGAAGAGAAAAGCTTTGTTGC -3'

Sequencing Primer
(F):5'- ATGTCTTACCCAAGTGGATGC -3'
(R):5'- CCTGAAAATGATAGGCCC -3'
Posted On2018-11-06