Incidental Mutation 'R6895:Nup62'
ID538282
Institutional Source Beutler Lab
Gene Symbol Nup62
Ensembl Gene ENSMUSG00000109511
Gene Namenucleoporin 62
SynonymsNupc1, p62, D7Ertd649e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44816088-44830812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44829733 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 391 (K391E)
Ref Sequence ENSEMBL: ENSMUSP00000146695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047085] [ENSMUST00000057195] [ENSMUST00000118125] [ENSMUST00000207085] [ENSMUST00000207103] [ENSMUST00000208172] [ENSMUST00000208626]
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057195
AA Change: K391E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056785
Gene: ENSMUSG00000109511
AA Change: K391E

DomainStartEndE-ValueType
low complexity region 3 81 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 199 251 N/A INTRINSIC
low complexity region 262 296 N/A INTRINSIC
Pfam:Nsp1_C 317 433 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207085
Predicted Effect possibly damaging
Transcript: ENSMUST00000207103
AA Change: K391E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000208172
Predicted Effect possibly damaging
Transcript: ENSMUST00000208626
AA Change: K391E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Nup62
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1542:Nup62 UTSW 7 44829929 missense possibly damaging 0.53
R1867:Nup62 UTSW 7 44829048 missense possibly damaging 0.92
R1868:Nup62 UTSW 7 44829048 missense possibly damaging 0.92
R2100:Nup62 UTSW 7 44829497 unclassified probably benign
R4884:Nup62 UTSW 7 44828865 missense probably damaging 0.99
R4977:Nup62 UTSW 7 44829025 missense possibly damaging 0.92
R5808:Nup62 UTSW 7 44829992 missense possibly damaging 0.53
R6052:Nup62 UTSW 7 44829040 missense possibly damaging 0.93
X0026:Nup62 UTSW 7 44828974 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGCGATGACCTATGCACAG -3'
(R):5'- TGTTCAGGTGCTCGATGATATCC -3'

Sequencing Primer
(F):5'- CTATGCACAGCTGGAAAGCTTGATC -3'
(R):5'- ATGCGCTTGAGCTGAGCATC -3'
Posted On2018-11-06