Incidental Mutation 'R6895:Inpp5j'
ID538294
Institutional Source Beutler Lab
Gene Symbol Inpp5j
Ensembl Gene ENSMUSG00000034570
Gene Nameinositol polyphosphate 5-phosphatase J
SynonymsPipp, Pib5pa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3494375-3504821 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 3495557 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000064265] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]
Predicted Effect probably null
Transcript: ENSMUST00000044507
SMART Domains Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 840 862 N/A INTRINSIC
low complexity region 868 887 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 992 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044682
SMART Domains Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 431 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064265
SMART Domains Protein: ENSMUSP00000068699
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 426 5.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110018
SMART Domains Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110019
SMART Domains Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148939
Predicted Effect probably benign
Transcript: ENSMUST00000154756
SMART Domains Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 870 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183684
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Inpp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Inpp5j APN 11 3500009 splice site probably benign
IGL00435:Inpp5j APN 11 3502255 missense probably benign 0.00
IGL00509:Inpp5j APN 11 3501595 missense possibly damaging 0.94
IGL00916:Inpp5j APN 11 3502389 missense probably damaging 1.00
IGL00975:Inpp5j APN 11 3502176 missense probably damaging 1.00
IGL01523:Inpp5j APN 11 3495932 splice site probably null
IGL02472:Inpp5j APN 11 3495338 unclassified probably benign
IGL02512:Inpp5j APN 11 3499661 missense probably damaging 1.00
IGL02897:Inpp5j APN 11 3500619 missense probably damaging 1.00
IGL03408:Inpp5j APN 11 3502809 missense possibly damaging 0.95
R0048:Inpp5j UTSW 11 3501417 missense probably damaging 0.97
R0440:Inpp5j UTSW 11 3501150 missense possibly damaging 0.95
R0455:Inpp5j UTSW 11 3503122 missense possibly damaging 0.66
R0483:Inpp5j UTSW 11 3499738 missense probably damaging 1.00
R0554:Inpp5j UTSW 11 3499644 missense probably damaging 1.00
R0639:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0673:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0926:Inpp5j UTSW 11 3501439 splice site probably benign
R1114:Inpp5j UTSW 11 3494814 missense possibly damaging 0.57
R1132:Inpp5j UTSW 11 3502305 missense possibly damaging 0.90
R1463:Inpp5j UTSW 11 3501147 missense probably benign 0.03
R1757:Inpp5j UTSW 11 3504738 missense possibly damaging 0.49
R1978:Inpp5j UTSW 11 3502150 missense probably damaging 1.00
R3078:Inpp5j UTSW 11 3503124 splice site probably null
R3831:Inpp5j UTSW 11 3500229 missense probably damaging 1.00
R4012:Inpp5j UTSW 11 3500185 missense probably benign 0.06
R4183:Inpp5j UTSW 11 3501134 missense probably damaging 0.99
R4209:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4210:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4211:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4477:Inpp5j UTSW 11 3501625 missense probably damaging 1.00
R4729:Inpp5j UTSW 11 3495025 missense probably damaging 0.99
R4840:Inpp5j UTSW 11 3499676 missense probably damaging 1.00
R5025:Inpp5j UTSW 11 3500664 missense probably damaging 1.00
R5151:Inpp5j UTSW 11 3502270 missense probably damaging 1.00
R5195:Inpp5j UTSW 11 3499889 critical splice donor site probably null
R5623:Inpp5j UTSW 11 3494766 missense probably damaging 0.96
R6262:Inpp5j UTSW 11 3502615 missense probably benign 0.02
R6448:Inpp5j UTSW 11 3495387 missense probably damaging 0.99
R6465:Inpp5j UTSW 11 3502293 missense possibly damaging 0.84
R6723:Inpp5j UTSW 11 3500640 missense probably damaging 0.99
R7060:Inpp5j UTSW 11 3500133 splice site probably null
R7346:Inpp5j UTSW 11 3501065 missense probably damaging 1.00
R8026:Inpp5j UTSW 11 3495171 missense
R8360:Inpp5j UTSW 11 3499767 missense probably damaging 0.99
T0975:Inpp5j UTSW 11 3502527 missense possibly damaging 0.69
Z1176:Inpp5j UTSW 11 3502484 nonsense probably null
Z1177:Inpp5j UTSW 11 3502191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGGTGGCTATAGTAACCC -3'
(R):5'- TACCGGGTAAGACTCTGCAG -3'

Sequencing Primer
(F):5'- TAGTAACCCAGAATGAAGTCTCCGTG -3'
(R):5'- CTCTGCAGGAAGGAAGTCACTCTG -3'
Posted On2018-11-06