Incidental Mutation 'R6895:Slc26a3'
ID538295
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Namesolute carrier family 26, member 3
Synonyms9030623B18Rik, 9130013M11Rik, Dra
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31390871-31473917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31463524 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 482 (A482S)
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000171616]
Predicted Effect probably damaging
Transcript: ENSMUST00000001254
AA Change: A482S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225
AA Change: A482S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31452491 splice site probably benign
IGL01717:Slc26a3 APN 12 31463477 missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31447831 missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31470833 splice site probably benign
IGL02445:Slc26a3 APN 12 31457052 missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31457096 missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31452629 missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31470950 missense probably benign 0.01
R0422:Slc26a3 UTSW 12 31465849 missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31447740 missense probably benign
R0781:Slc26a3 UTSW 12 31465813 missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31466452 missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31465846 missense probably benign
R1954:Slc26a3 UTSW 12 31450816 missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31465778 missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31457072 missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31470903 missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31464720 missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31453906 missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31465860 splice site probably null
R4701:Slc26a3 UTSW 12 31447774 missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31457080 missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31453908 missense probably benign
R5058:Slc26a3 UTSW 12 31470965 missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31468554 missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31450981 critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31448843 critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31452715 intron probably benign
R6662:Slc26a3 UTSW 12 31457346 nonsense probably null
R7069:Slc26a3 UTSW 12 31450935 missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31447788 missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31463465 critical splice acceptor site probably null
R8192:Slc26a3 UTSW 12 31468542 missense probably benign 0.05
R8327:Slc26a3 UTSW 12 31466431 missense possibly damaging 0.81
R8371:Slc26a3 UTSW 12 31452542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGACCTTTTGAGACATGTCTTTG -3'
(R):5'- ATGGTCTTGATAGGCACGCATG -3'

Sequencing Primer
(F):5'- TGTTCCCTGGCCCAAGATAAC -3'
(R):5'- GCATGCTATCAAACACACTGCTC -3'
Posted On2018-11-06