Incidental Mutation 'R6895:Dnaaf2'
ID538298
Institutional Source Beutler Lab
Gene Symbol Dnaaf2
Ensembl Gene ENSMUSG00000020973
Gene Namedynein, axonemal assembly factor 2
Synonyms2810020C19Rik, kintoun, Ktu, 1110034A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6895 (G1)
Quality Score176.009
Status Validated
Chromosome12
Chromosomal Location69189087-69198429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69197663 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000021356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
Predicted Effect probably benign
Transcript: ENSMUST00000021356
AA Change: V208A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in the human gene have been associated with primary ciliary dyskinesia. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, reduced body size, situs inversus totalis, hydroencephaly and abnormal brain ependymal and tracheal cilia morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Dnaaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Dnaaf2 APN 12 69196766 missense probably benign 0.23
IGL01321:Dnaaf2 APN 12 69196602 missense probably damaging 1.00
IGL01880:Dnaaf2 APN 12 69190037 missense probably benign 0.17
R0329:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R0330:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R1051:Dnaaf2 UTSW 12 69197795 missense probably damaging 1.00
R1668:Dnaaf2 UTSW 12 69196691 missense probably benign 0.04
R2011:Dnaaf2 UTSW 12 69196785 missense probably damaging 1.00
R2179:Dnaaf2 UTSW 12 69198297 unclassified probably benign
R2243:Dnaaf2 UTSW 12 69196644 missense possibly damaging 0.83
R2356:Dnaaf2 UTSW 12 69198218 missense probably benign 0.01
R4120:Dnaaf2 UTSW 12 69198038 missense possibly damaging 0.85
R5086:Dnaaf2 UTSW 12 69197286 missense probably damaging 1.00
R5205:Dnaaf2 UTSW 12 69192924 missense probably damaging 1.00
R5300:Dnaaf2 UTSW 12 69198228 missense probably damaging 0.99
R5399:Dnaaf2 UTSW 12 69196742 missense probably damaging 0.97
R5739:Dnaaf2 UTSW 12 69196941 missense probably benign
R5765:Dnaaf2 UTSW 12 69192853 missense probably damaging 1.00
R5872:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6043:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6338:Dnaaf2 UTSW 12 69198122 missense probably damaging 1.00
R6503:Dnaaf2 UTSW 12 69197511 missense probably benign 0.42
R6524:Dnaaf2 UTSW 12 69190385 missense probably benign 0.43
R7490:Dnaaf2 UTSW 12 69197606 missense probably damaging 1.00
R7971:Dnaaf2 UTSW 12 69197345 missense probably damaging 1.00
R8209:Dnaaf2 UTSW 12 69198092 missense probably damaging 1.00
Z1176:Dnaaf2 UTSW 12 69197850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCCTGGAGGTCTACGTGG -3'
(R):5'- TGTGCAGCAACTCACTGGTAG -3'

Sequencing Primer
(F):5'- AGGTCTACGTGGTGGCGC -3'
(R):5'- AGCAACTCACTGGTAGGCGTAC -3'
Posted On2018-11-06