Incidental Mutation 'R6895:Ankrd29'
ID538309
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12260989 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect probably benign
Transcript: ENSMUST00000118525
AA Change: V256A

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: V256A

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122408
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3693:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3694:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3699:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4132:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6627:Ankrd29 UTSW 18 12262164 missense probably benign 0.02
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAACTATGAATGCAACCGGC -3'
(R):5'- ATGTGACTTTAGGAAGTGCAGG -3'

Sequencing Primer
(F):5'- CTGTGTGCAACTATGAATGCAACC -3'
(R):5'- CTTTAGGAAGTGCAGGGAAGACAC -3'
Posted On2018-11-06