Incidental Mutation 'R6896:Zdbf2'
ID 538311
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 044990-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6896 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63348031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 2137 (R2137W)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably damaging
Transcript: ENSMUST00000029025
AA Change: R2137W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: R2137W

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114132
AA Change: R2137W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: R2137W

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,660,298 (GRCm39) L454P probably damaging Het
Acadm T C 3: 153,641,957 (GRCm39) I192V probably damaging Het
Acadsb T A 7: 131,045,375 (GRCm39) Y436N probably benign Het
Ache G A 5: 137,289,996 (GRCm39) V442M probably damaging Het
Adam39 A T 8: 41,277,975 (GRCm39) N122I possibly damaging Het
Akap6 A T 12: 52,934,277 (GRCm39) I590F probably benign Het
Akap8 T C 17: 32,536,305 (GRCm39) N36S probably benign Het
Asap2 T C 12: 21,315,526 (GRCm39) S933P probably damaging Het
C3 C T 17: 57,527,864 (GRCm39) probably null Het
Cdon T A 9: 35,363,402 (GRCm39) M1K probably null Het
Cemip T A 7: 83,647,784 (GRCm39) I99F probably damaging Het
Cfap251 A G 5: 123,416,421 (GRCm39) T565A possibly damaging Het
Cfap58 T G 19: 47,932,626 (GRCm39) L130R probably damaging Het
Clca3a2 T C 3: 144,514,462 (GRCm39) D415G probably damaging Het
Coch A G 12: 51,649,652 (GRCm39) D321G possibly damaging Het
Dync2i1 C T 12: 116,193,291 (GRCm39) G554R possibly damaging Het
Efcab11 A G 12: 99,849,674 (GRCm39) probably benign Het
Ermap G T 4: 119,044,328 (GRCm39) S156* probably null Het
Fap G T 2: 62,334,944 (GRCm39) Y620* probably null Het
Galntl5 T C 5: 25,394,947 (GRCm39) probably null Het
Il21r C A 7: 125,226,128 (GRCm39) H76N probably damaging Het
Itpr1 T G 6: 108,458,355 (GRCm39) Y2041D probably damaging Het
Megf8 T A 7: 25,029,357 (GRCm39) N300K probably benign Het
Muc2 G A 7: 141,306,432 (GRCm39) V285I possibly damaging Het
Myh15 A T 16: 48,933,434 (GRCm39) Q623L probably benign Het
Myh7b T C 2: 155,464,488 (GRCm39) probably null Het
Naaladl1 T A 19: 6,159,335 (GRCm39) probably null Het
Nlrp9b T G 7: 19,757,170 (GRCm39) F136V probably damaging Het
Oprd1 A T 4: 131,844,612 (GRCm39) M132K probably damaging Het
Or10a3b T C 7: 108,444,750 (GRCm39) T156A probably benign Het
Or4s2b A G 2: 88,508,340 (GRCm39) N47S probably damaging Het
Or6c70 A T 10: 129,710,623 (GRCm39) M1K probably null Het
Or9g4 A G 2: 85,505,277 (GRCm39) Y73H probably damaging Het
Patj T A 4: 98,314,287 (GRCm39) V369D possibly damaging Het
Pcdhb3 T C 18: 37,434,265 (GRCm39) L77P probably damaging Het
Pcf11 T C 7: 92,298,759 (GRCm39) D1259G probably damaging Het
Pdcl A T 2: 37,242,191 (GRCm39) H186Q probably damaging Het
Pdzd9 A T 7: 120,262,095 (GRCm39) *77R probably null Het
Reln C T 5: 22,104,177 (GRCm39) E3265K probably benign Het
Smg8 T C 11: 86,968,787 (GRCm39) T990A possibly damaging Het
Smok2a C T 17: 13,444,758 (GRCm39) H112Y probably benign Het
Spatc1l G A 10: 76,405,242 (GRCm39) R208H probably damaging Het
Taf7 T C 18: 37,775,733 (GRCm39) D278G possibly damaging Het
Vipas39 T C 12: 87,289,345 (GRCm39) N373S probably benign Het
Vmn2r78 C T 7: 86,571,558 (GRCm39) T456I probably benign Het
Vwf T C 6: 125,543,157 (GRCm39) S148P probably damaging Het
Xpot A C 10: 121,449,390 (GRCm39) probably null Het
Zfp462 T A 4: 55,009,544 (GRCm39) N503K possibly damaging Het
Zfp641 T A 15: 98,191,684 (GRCm39) M1L probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGTTTCAACATCTTTTATGGC -3'
(R):5'- GTCTTTGATAGATGCCTCCGGG -3'

Sequencing Primer
(F):5'- GGTTTCAACATCTTTTATGGCAATGC -3'
(R):5'- CCTCCGGGGCATAAGACC -3'
Posted On 2018-11-06