Incidental Mutation 'R6896:Olfr1193'
ID538315
Institutional Source Beutler Lab
Gene Symbol Olfr1193
Ensembl Gene ENSMUSG00000060827
Gene Nameolfactory receptor 1193
SynonymsGA_x6K02T2Q125-50154044-50154826, GA_x6K02T2Q125-50158288-50158818, Olfr1194-ps1, MOR226-1, MOR230-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88675628-88681143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88677996 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 47 (N47S)
Ref Sequence ENSEMBL: ENSMUSP00000080399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
Predicted Effect probably damaging
Transcript: ENSMUST00000081697
AA Change: N47S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827
AA Change: N47S

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
Predicted Effect probably damaging
Transcript: ENSMUST00000213893
AA Change: N40S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216767
AA Change: N40S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4583 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Olfr1193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Olfr1193 APN 2 88678733 missense probably damaging 1.00
R0322:Olfr1193 UTSW 2 88678667 missense probably damaging 0.98
R0711:Olfr1193 UTSW 2 88678674 missense probably damaging 1.00
R1500:Olfr1193 UTSW 2 88677875 missense possibly damaging 0.73
R1610:Olfr1193 UTSW 2 88678574 nonsense probably null
R4380:Olfr1193 UTSW 2 88678271 missense possibly damaging 0.61
R4602:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4602:Olfr1193 UTSW 2 88678179 missense probably benign
R4610:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4610:Olfr1193 UTSW 2 88678179 missense probably benign
R4790:Olfr1193 UTSW 2 88678387 missense possibly damaging 0.73
R4803:Olfr1193 UTSW 2 88678022 missense probably benign 0.34
R5402:Olfr1193 UTSW 2 88678148 missense possibly damaging 0.74
R5736:Olfr1193 UTSW 2 88678641 missense probably benign 0.00
R6998:Olfr1193 UTSW 2 88678508 missense probably benign 0.23
R7038:Olfr1193 UTSW 2 88678741 missense probably damaging 1.00
X0022:Olfr1193 UTSW 2 88678320 missense probably benign 0.08
Z1088:Olfr1193 UTSW 2 88678664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATTAACTTCAACCAGTAGCCAC -3'
(R):5'- TTGTAACATGCACCCCACATAGG -3'

Sequencing Primer
(F):5'- CTTCAACCAGTAGCCACTATAATTAC -3'
(R):5'- TGCACCCCACATAGGATATAGTC -3'
Posted On2018-11-06