Incidental Mutation 'R6896:Ermap'
ID538321
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 119187131 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 156 (S156*)
Ref Sequence ENSEMBL: ENSMUSP00000123426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000124626] [ENSMUST00000133956] [ENSMUST00000138395] [ENSMUST00000141227] [ENSMUST00000150864] [ENSMUST00000156746]
Predicted Effect probably null
Transcript: ENSMUST00000030396
AA Change: S156*
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644
AA Change: S156*

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124626
AA Change: S156*
SMART Domains Protein: ENSMUSP00000120202
Gene: ENSMUSG00000028644
AA Change: S156*

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133956
AA Change: S130*
SMART Domains Protein: ENSMUSP00000120181
Gene: ENSMUSG00000028644
AA Change: S130*

DomainStartEndE-ValueType
IGv 42 125 9.26e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138395
AA Change: S156*
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: S156*

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141227
Predicted Effect probably benign
Transcript: ENSMUST00000150864
Predicted Effect probably benign
Transcript: ENSMUST00000156746
SMART Domains Protein: ENSMUSP00000118640
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
Blast:IG 78 107 6e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R0737:Ermap UTSW 4 119178510 missense probably damaging 1.00
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4128:Ermap UTSW 4 119187111 missense possibly damaging 0.89
R4588:Ermap UTSW 4 119188248 intron probably benign
R4853:Ermap UTSW 4 119187254 missense probably damaging 1.00
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6275:Ermap UTSW 4 119178550 missense probably damaging 1.00
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6458:Ermap UTSW 4 119178140 missense probably damaging 1.00
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
R7445:Ermap UTSW 4 119188710 missense unknown
Z1177:Ermap UTSW 4 119185561
Predicted Primers PCR Primer
(F):5'- TCCAAAGTCCAAGTTCCTCC -3'
(R):5'- CCTCTGGCCTAACATGGTAC -3'

Sequencing Primer
(F):5'- AAAGTCCAAGTTCCTCCCCTCC -3'
(R):5'- TGGCCTAACATGGTACTCAGC -3'
Posted On2018-11-06