Incidental Mutation 'R6896:Galntl5'
ID538324
Institutional Source Beutler Lab
Gene Symbol Galntl5
Ensembl Gene ENSMUSG00000028938
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms1700021B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location25181460-25220297 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 25189949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030778] [ENSMUST00000114965]
Predicted Effect probably null
Transcript: ENSMUST00000030778
SMART Domains Protein: ENSMUSP00000030778
Gene: ENSMUSG00000028938

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 365 4.1e-10 PFAM
Pfam:Glycos_transf_2 118 304 4.2e-30 PFAM
Pfam:Glyco_tranf_2_2 118 383 1.7e-7 PFAM
Pfam:Glyco_transf_7C 277 349 2.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114965
SMART Domains Protein: ENSMUSP00000110616
Gene: ENSMUSG00000028938

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 82 332 1.8e-10 PFAM
Pfam:Glycos_transf_2 85 271 3.3e-28 PFAM
Pfam:Glyco_tranf_2_2 85 350 8.1e-8 PFAM
Pfam:Glyco_transf_7C 244 316 2.4e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Male heterozygous mice for this allele were infertile due to decreased sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Galntl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Galntl5 APN 5 25195351 missense probably damaging 1.00
IGL01637:Galntl5 APN 5 25189825 splice site probably benign
IGL02126:Galntl5 APN 5 25189841 missense possibly damaging 0.75
IGL02136:Galntl5 APN 5 25220062 missense probably benign 0.16
IGL02836:Galntl5 APN 5 25186239 missense probably benign
R0076:Galntl5 UTSW 5 25186072 critical splice acceptor site probably null
R0411:Galntl5 UTSW 5 25220174 missense probably benign 0.20
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1686:Galntl5 UTSW 5 25210434 missense probably benign 0.16
R1724:Galntl5 UTSW 5 25220122 missense possibly damaging 0.94
R1899:Galntl5 UTSW 5 25198532 nonsense probably null
R2213:Galntl5 UTSW 5 25217529 missense probably benign 0.13
R2215:Galntl5 UTSW 5 25198478 missense probably damaging 1.00
R2425:Galntl5 UTSW 5 25220081 missense probably damaging 0.99
R3811:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R3812:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R4072:Galntl5 UTSW 5 25198480 nonsense probably null
R4660:Galntl5 UTSW 5 25203379 missense probably damaging 1.00
R5792:Galntl5 UTSW 5 25198463 missense possibly damaging 0.59
R5844:Galntl5 UTSW 5 25186093 intron probably benign
R6267:Galntl5 UTSW 5 25186165 missense probably benign
R6296:Galntl5 UTSW 5 25186165 missense probably benign
R7138:Galntl5 UTSW 5 25189844 missense probably benign 0.13
R7256:Galntl5 UTSW 5 25195300 missense probably benign 0.00
Z1176:Galntl5 UTSW 5 25203189 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGGTTAGTTTAGAGACCAAG -3'
(R):5'- AATGCTTTGGACAGAACTGAGG -3'

Sequencing Primer
(F):5'- GAATGCATCTGCGTAACAGC -3'
(R):5'- CTTTGGACAGAACTGAGGAAAAATCC -3'
Posted On2018-11-06