Incidental Mutation 'R6896:Cemip'
ID538332
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83998576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 99 (I99F)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: I99F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: I99F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Meta Mutation Damage Score 0.8228 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R8005:Cemip UTSW 7 84003408
RF008:Cemip UTSW 7 83961635 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296
Predicted Primers PCR Primer
(F):5'- TATGGTCTAGTAGGACACAGTGG -3'
(R):5'- GAAGTGCTGAAAAGATGCCC -3'

Sequencing Primer
(F):5'- CTAGTAGGACACAGTGGGGTTCC -3'
(R):5'- AAAGATGCCCTTTTGTCTGCCTAAG -3'
Posted On2018-11-06