Mutagenetix > Incidental Mutations

Incidental Mutation 'R6896:Vmn2r78'

538333

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r78

Ensembl Gene

ENSMUSG00000091962

Gene Name

vomeronasal 2, receptor 78

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6896 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86915300-86955177 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86922350 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 456 (T456I)

Ref Sequence

ENSEMBL: ENSMUSP00000126698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170835]

Predicted Effect

probably benign
Transcript: ENSMUST00000170835
AA Change: T456I

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: T456I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	5.9e-31	PFAM
Pfam:NCD3G	507	559	8.1e-21	PFAM
Pfam:7tm_3	592	827	1e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (49/50)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	C	6: 58,683,313	L454P	probably damaging	Het
Acadm	T	C	3: 153,936,320	I192V	probably damaging	Het
Acadsb	T	A	7: 131,443,646	Y436N	probably benign	Het
Ache	G	A	5: 137,291,734	V442M	probably damaging	Het
Adam39	A	T	8: 40,824,938	N122I	possibly damaging	Het
Akap6	A	T	12: 52,887,494	I590F	probably benign	Het
Akap8	T	C	17: 32,317,331	N36S	probably benign	Het
Asap2	T	C	12: 21,265,525	S933P	probably damaging	Het
C3	C	T	17: 57,220,864		probably null	Het
Cdon	T	A	9: 35,452,106	M1K	probably null	Het
Cemip	T	A	7: 83,998,576	I99F	probably damaging	Het
Cfap58	T	G	19: 47,944,187	L130R	probably damaging	Het
Clca3a2	T	C	3: 144,808,701	D415G	probably damaging	Het
Coch	A	G	12: 51,602,869	D321G	possibly damaging	Het
Efcab11	A	G	12: 99,883,415		probably benign	Het
Ermap	G	T	4: 119,187,131	S156*	probably null	Het
Fap	G	T	2: 62,504,600	Y620*	probably null	Het
Galntl5	T	C	5: 25,189,949		probably null	Het
Il21r	C	A	7: 125,626,956	H76N	probably damaging	Het
Itpr1	T	G	6: 108,481,394	Y2041D	probably damaging	Het
Megf8	T	A	7: 25,329,932	N300K	probably benign	Het
Muc2	G	A	7: 141,752,695	V285I	possibly damaging	Het
Myh15	A	T	16: 49,113,071	Q623L	probably benign	Het
Myh7b	T	C	2: 155,622,568		probably null	Het
Naaladl1	T	A	19: 6,109,305		probably null	Het
Nlrp9b	T	G	7: 20,023,245	F136V	probably damaging	Het
Olfr1006	A	G	2: 85,674,933	Y73H	probably damaging	Het
Olfr1193	A	G	2: 88,677,996	N47S	probably damaging	Het
Olfr516	T	C	7: 108,845,543	T156A	probably benign	Het
Olfr814	A	T	10: 129,874,754	M1K	probably null	Het
Oprd1	A	T	4: 132,117,301	M132K	probably damaging	Het
Patj	T	A	4: 98,426,050	V369D	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,212	L77P	probably damaging	Het
Pcf11	T	C	7: 92,649,551	D1259G	probably damaging	Het
Pdcl	A	T	2: 37,352,179	H186Q	probably damaging	Het
Pdzd9	A	T	7: 120,662,872	*77R	probably null	Het
Reln	C	T	5: 21,899,179	E3265K	probably benign	Het
Smg8	T	C	11: 87,077,961	T990A	possibly damaging	Het
Smok2a	C	T	17: 13,225,871	H112Y	probably benign	Het
Spatc1l	G	A	10: 76,569,408	R208H	probably damaging	Het
Taf7	T	C	18: 37,642,680	D278G	possibly damaging	Het
Vipas39	T	C	12: 87,242,571	N373S	probably benign	Het
Vwf	T	C	6: 125,566,194	S148P	probably damaging	Het
Wdr60	C	T	12: 116,229,671	G554R	possibly damaging	Het
Wdr66	A	G	5: 123,278,358	T565A	possibly damaging	Het
Xpot	A	C	10: 121,613,485		probably null	Het
Zdbf2	A	T	1: 63,308,872	R2137W	probably damaging	Het
Zfp462	T	A	4: 55,009,544	N503K	possibly damaging	Het
Zfp641	T	A	15: 98,293,803	M1L	probably benign	Het

Other mutations in Vmn2r78

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Vmn2r78	APN	7	86915361	missense	unknown
IGL01473:Vmn2r78	APN	7	86920312	missense	possibly damaging	0.61
IGL01767:Vmn2r78	APN	7	86954435	missense	probably benign	0.28
IGL02322:Vmn2r78	APN	7	86921479	missense	probably damaging	0.96
IGL02537:Vmn2r78	APN	7	86954288	missense	probably damaging	0.99
IGL03297:Vmn2r78	APN	7	86920761	nonsense	probably null
ANU74:Vmn2r78	UTSW	7	86921065	missense	possibly damaging	0.62
R0035:Vmn2r78	UTSW	7	86920205	missense	probably benign	0.22
R0081:Vmn2r78	UTSW	7	86923027	missense	probably benign	0.35
R0401:Vmn2r78	UTSW	7	86921311	missense	probably benign	0.04
R0751:Vmn2r78	UTSW	7	86954380	missense	possibly damaging	0.77
R1341:Vmn2r78	UTSW	7	86922269	missense	possibly damaging	0.71
R1386:Vmn2r78	UTSW	7	86915407	missense	unknown
R1526:Vmn2r78	UTSW	7	86922257	splice site	probably null
R1712:Vmn2r78	UTSW	7	86954924	missense	probably damaging	1.00
R1739:Vmn2r78	UTSW	7	86920789	missense	probably benign
R1812:Vmn2r78	UTSW	7	86920787	missense	probably benign	0.38
R2011:Vmn2r78	UTSW	7	86955079	missense	possibly damaging	0.52
R2144:Vmn2r78	UTSW	7	86954482	missense	probably damaging	1.00
R2197:Vmn2r78	UTSW	7	86921327	missense	probably damaging	0.96
R2291:Vmn2r78	UTSW	7	86920154	missense	probably damaging	1.00
R2409:Vmn2r78	UTSW	7	86920745	splice site	probably benign
R3023:Vmn2r78	UTSW	7	86954966	missense	probably damaging	1.00
R4486:Vmn2r78	UTSW	7	86920751	critical splice acceptor site	probably null
R4512:Vmn2r78	UTSW	7	86920244	missense	probably benign	0.00
R4515:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R4544:Vmn2r78	UTSW	7	86921191	missense	probably benign
R4546:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R4872:Vmn2r78	UTSW	7	86954708	missense	possibly damaging	0.87
R4928:Vmn2r78	UTSW	7	86954627	missense	probably damaging	1.00
R5101:Vmn2r78	UTSW	7	86922355	missense	probably damaging	1.00
R5265:Vmn2r78	UTSW	7	86920124	missense	probably damaging	1.00
R5328:Vmn2r78	UTSW	7	86921030	missense	probably damaging	0.98
R5442:Vmn2r78	UTSW	7	86920122	missense	possibly damaging	0.95
R5567:Vmn2r78	UTSW	7	86921529	missense	probably benign	0.17
R5572:Vmn2r78	UTSW	7	86915512	missense	probably benign	0.01
R5636:Vmn2r78	UTSW	7	86954429	missense	probably damaging	0.99
R5901:Vmn2r78	UTSW	7	86954588	missense	probably damaging	1.00
R5977:Vmn2r78	UTSW	7	86920333	missense	possibly damaging	0.74
R5977:Vmn2r78	UTSW	7	86954907	missense	probably benign	0.00
R6276:Vmn2r78	UTSW	7	86921110	missense	probably benign	0.00
R6386:Vmn2r78	UTSW	7	86922337	nonsense	probably null
R6724:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R6852:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R7385:Vmn2r78	UTSW	7	86922425	missense	probably benign	0.18
R7578:Vmn2r78	UTSW	7	86954344	nonsense	probably null
R7680:Vmn2r78	UTSW	7	86954941	missense	probably damaging	1.00
R7748:Vmn2r78	UTSW	7	86921135	missense	probably benign	0.00
R7852:Vmn2r78	UTSW	7	86920170	nonsense	probably null
R7935:Vmn2r78	UTSW	7	86920170	nonsense	probably null
RF018:Vmn2r78	UTSW	7	86954431	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGATAATGGATATGAGTGGCATTCC -3'
(R):5'- ACCGAACGATCTCCCTTTAC -3'

Sequencing Primer
(F):5'- GTGGCATTCCAATCTTTATGATTTC -3'
(R):5'- TCATGAAACATGAGTGAGTGAATG -3'

Posted On

2018-11-06