Incidental Mutation 'R6896:Pdzd9'
ID538336
Institutional Source Beutler Lab
Gene Symbol Pdzd9
Ensembl Gene ENSMUSG00000030887
Gene NamePDZ domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120658731-120670343 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 120662872 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 77 (*77R)
Ref Sequence ENSEMBL: ENSMUSP00000147114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033176] [ENSMUST00000033178] [ENSMUST00000127845] [ENSMUST00000208635]
Predicted Effect probably benign
Transcript: ENSMUST00000033176
SMART Domains Protein: ENSMUSP00000033176
Gene: ENSMUSG00000030884

DomainStartEndE-ValueType
Pfam:Peptidase_M16 48 194 3.2e-33 PFAM
Pfam:Peptidase_M16_C 199 378 2.2e-26 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000033178
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000033178
Gene: ENSMUSG00000030887
AA Change: Y122*

DomainStartEndE-ValueType
PDZ 38 111 2.97e-8 SMART
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127845
AA Change: *77R
Predicted Effect probably benign
Transcript: ENSMUST00000208635
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Pdzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pdzd9 APN 7 120660271 missense possibly damaging 0.92
IGL01295:Pdzd9 APN 7 120668395 missense probably damaging 1.00
IGL02252:Pdzd9 APN 7 120663015 missense probably benign 0.00
IGL02393:Pdzd9 APN 7 120662983 nonsense probably null
R0826:Pdzd9 UTSW 7 120668401 missense probably damaging 0.99
R4130:Pdzd9 UTSW 7 120662869 missense possibly damaging 0.81
R4131:Pdzd9 UTSW 7 120662869 missense possibly damaging 0.81
R4820:Pdzd9 UTSW 7 120668396 missense probably damaging 1.00
R4915:Pdzd9 UTSW 7 120670168 missense possibly damaging 0.82
R5883:Pdzd9 UTSW 7 120668553 missense possibly damaging 0.60
R6283:Pdzd9 UTSW 7 120660226 missense possibly damaging 0.66
R7017:Pdzd9 UTSW 7 120663002 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTGCAGAATGTCCTTTGTAG -3'
(R):5'- CAGTACAGCTCTTTTCAAGCC -3'

Sequencing Primer
(F):5'- GAAGAATGTCATTCACTAAGCCCTGG -3'
(R):5'- ACAGCTCTTTTCAAGCCATTATTTC -3'
Posted On2018-11-06