Mutagenetix > Incidental Mutations

Incidental Mutation 'R6896:Muc2'

538339

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6896 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141752695 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 285 (V285I)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026590
AA Change: V285I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: V285I

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: V724I

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	C	6: 58,683,313	L454P	probably damaging	Het
Acadm	T	C	3: 153,936,320	I192V	probably damaging	Het
Acadsb	T	A	7: 131,443,646	Y436N	probably benign	Het
Ache	G	A	5: 137,291,734	V442M	probably damaging	Het
Adam39	A	T	8: 40,824,938	N122I	possibly damaging	Het
Akap6	A	T	12: 52,887,494	I590F	probably benign	Het
Akap8	T	C	17: 32,317,331	N36S	probably benign	Het
Asap2	T	C	12: 21,265,525	S933P	probably damaging	Het
C3	C	T	17: 57,220,864		probably null	Het
Cdon	T	A	9: 35,452,106	M1K	probably null	Het
Cemip	T	A	7: 83,998,576	I99F	probably damaging	Het
Cfap58	T	G	19: 47,944,187	L130R	probably damaging	Het
Clca3a2	T	C	3: 144,808,701	D415G	probably damaging	Het
Coch	A	G	12: 51,602,869	D321G	possibly damaging	Het
Efcab11	A	G	12: 99,883,415		probably benign	Het
Ermap	G	T	4: 119,187,131	S156*	probably null	Het
Fap	G	T	2: 62,504,600	Y620*	probably null	Het
Galntl5	T	C	5: 25,189,949		probably null	Het
Il21r	C	A	7: 125,626,956	H76N	probably damaging	Het
Itpr1	T	G	6: 108,481,394	Y2041D	probably damaging	Het
Megf8	T	A	7: 25,329,932	N300K	probably benign	Het
Myh15	A	T	16: 49,113,071	Q623L	probably benign	Het
Myh7b	T	C	2: 155,622,568		probably null	Het
Naaladl1	T	A	19: 6,109,305		probably null	Het
Nlrp9b	T	G	7: 20,023,245	F136V	probably damaging	Het
Olfr1006	A	G	2: 85,674,933	Y73H	probably damaging	Het
Olfr1193	A	G	2: 88,677,996	N47S	probably damaging	Het
Olfr516	T	C	7: 108,845,543	T156A	probably benign	Het
Olfr814	A	T	10: 129,874,754	M1K	probably null	Het
Oprd1	A	T	4: 132,117,301	M132K	probably damaging	Het
Patj	T	A	4: 98,426,050	V369D	possibly damaging	Het
Pcdhb3	T	C	18: 37,301,212	L77P	probably damaging	Het
Pcf11	T	C	7: 92,649,551	D1259G	probably damaging	Het
Pdcl	A	T	2: 37,352,179	H186Q	probably damaging	Het
Pdzd9	A	T	7: 120,662,872	*77R	probably null	Het
Reln	C	T	5: 21,899,179	E3265K	probably benign	Het
Smg8	T	C	11: 87,077,961	T990A	possibly damaging	Het
Smok2a	C	T	17: 13,225,871	H112Y	probably benign	Het
Spatc1l	G	A	10: 76,569,408	R208H	probably damaging	Het
Taf7	T	C	18: 37,642,680	D278G	possibly damaging	Het
Vipas39	T	C	12: 87,242,571	N373S	probably benign	Het
Vmn2r78	C	T	7: 86,922,350	T456I	probably benign	Het
Vwf	T	C	6: 125,566,194	S148P	probably damaging	Het
Wdr60	C	T	12: 116,229,671	G554R	possibly damaging	Het
Wdr66	A	G	5: 123,278,358	T565A	possibly damaging	Het
Xpot	A	C	10: 121,613,485		probably null	Het
Zdbf2	A	T	1: 63,308,872	R2137W	probably damaging	Het
Zfp462	T	A	4: 55,009,544	N503K	possibly damaging	Het
Zfp641	T	A	15: 98,293,803	M1L	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	unclassified	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7926:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7952:Muc2	UTSW	7	141749734	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TTCCCATCTTCTAAAAGACACATGG -3'
(R):5'- TGGGATTTAGGATGACTCAAGCC -3'

Sequencing Primer
(F):5'- TCTTCTAAAAGACACATGGTTTCATG -3'
(R):5'- TTTAGGATGACTCAAGCCCGAAGTC -3'

Posted On

2018-11-06