Mutagenetix > Incidental Mutation

Incidental Mutation 'R6896:Muc2'

538339

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044990-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6896 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141306432 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 285 (V285I)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026590
AA Change: V285I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: V285I

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: V724I

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	C	6: 58,660,298 (GRCm39)	L454P	probably damaging	Het
Acadm	T	C	3: 153,641,957 (GRCm39)	I192V	probably damaging	Het
Acadsb	T	A	7: 131,045,375 (GRCm39)	Y436N	probably benign	Het
Ache	G	A	5: 137,289,996 (GRCm39)	V442M	probably damaging	Het
Adam39	A	T	8: 41,277,975 (GRCm39)	N122I	possibly damaging	Het
Akap6	A	T	12: 52,934,277 (GRCm39)	I590F	probably benign	Het
Akap8	T	C	17: 32,536,305 (GRCm39)	N36S	probably benign	Het
Asap2	T	C	12: 21,315,526 (GRCm39)	S933P	probably damaging	Het
C3	C	T	17: 57,527,864 (GRCm39)		probably null	Het
Cdon	T	A	9: 35,363,402 (GRCm39)	M1K	probably null	Het
Cemip	T	A	7: 83,647,784 (GRCm39)	I99F	probably damaging	Het
Cfap251	A	G	5: 123,416,421 (GRCm39)	T565A	possibly damaging	Het
Cfap58	T	G	19: 47,932,626 (GRCm39)	L130R	probably damaging	Het
Clca3a2	T	C	3: 144,514,462 (GRCm39)	D415G	probably damaging	Het
Coch	A	G	12: 51,649,652 (GRCm39)	D321G	possibly damaging	Het
Dync2i1	C	T	12: 116,193,291 (GRCm39)	G554R	possibly damaging	Het
Efcab11	A	G	12: 99,849,674 (GRCm39)		probably benign	Het
Ermap	G	T	4: 119,044,328 (GRCm39)	S156*	probably null	Het
Fap	G	T	2: 62,334,944 (GRCm39)	Y620*	probably null	Het
Galntl5	T	C	5: 25,394,947 (GRCm39)		probably null	Het
Il21r	C	A	7: 125,226,128 (GRCm39)	H76N	probably damaging	Het
Itpr1	T	G	6: 108,458,355 (GRCm39)	Y2041D	probably damaging	Het
Megf8	T	A	7: 25,029,357 (GRCm39)	N300K	probably benign	Het
Myh15	A	T	16: 48,933,434 (GRCm39)	Q623L	probably benign	Het
Myh7b	T	C	2: 155,464,488 (GRCm39)		probably null	Het
Naaladl1	T	A	19: 6,159,335 (GRCm39)		probably null	Het
Nlrp9b	T	G	7: 19,757,170 (GRCm39)	F136V	probably damaging	Het
Oprd1	A	T	4: 131,844,612 (GRCm39)	M132K	probably damaging	Het
Or10a3b	T	C	7: 108,444,750 (GRCm39)	T156A	probably benign	Het
Or4s2b	A	G	2: 88,508,340 (GRCm39)	N47S	probably damaging	Het
Or6c70	A	T	10: 129,710,623 (GRCm39)	M1K	probably null	Het
Or9g4	A	G	2: 85,505,277 (GRCm39)	Y73H	probably damaging	Het
Patj	T	A	4: 98,314,287 (GRCm39)	V369D	possibly damaging	Het
Pcdhb3	T	C	18: 37,434,265 (GRCm39)	L77P	probably damaging	Het
Pcf11	T	C	7: 92,298,759 (GRCm39)	D1259G	probably damaging	Het
Pdcl	A	T	2: 37,242,191 (GRCm39)	H186Q	probably damaging	Het
Pdzd9	A	T	7: 120,262,095 (GRCm39)	*77R	probably null	Het
Reln	C	T	5: 22,104,177 (GRCm39)	E3265K	probably benign	Het
Smg8	T	C	11: 86,968,787 (GRCm39)	T990A	possibly damaging	Het
Smok2a	C	T	17: 13,444,758 (GRCm39)	H112Y	probably benign	Het
Spatc1l	G	A	10: 76,405,242 (GRCm39)	R208H	probably damaging	Het
Taf7	T	C	18: 37,775,733 (GRCm39)	D278G	possibly damaging	Het
Vipas39	T	C	12: 87,289,345 (GRCm39)	N373S	probably benign	Het
Vmn2r78	C	T	7: 86,571,558 (GRCm39)	T456I	probably benign	Het
Vwf	T	C	6: 125,543,157 (GRCm39)	S148P	probably damaging	Het
Xpot	A	C	10: 121,449,390 (GRCm39)		probably null	Het
Zdbf2	A	T	1: 63,348,031 (GRCm39)	R2137W	probably damaging	Het
Zfp462	T	A	4: 55,009,544 (GRCm39)	N503K	possibly damaging	Het
Zfp641	T	A	15: 98,191,684 (GRCm39)	M1L	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TTCCCATCTTCTAAAAGACACATGG -3'
(R):5'- TGGGATTTAGGATGACTCAAGCC -3'

Sequencing Primer
(F):5'- TCTTCTAAAAGACACATGGTTTCATG -3'
(R):5'- TTTAGGATGACTCAAGCCCGAAGTC -3'

Posted On

2018-11-06