Incidental Mutation 'R6896:Adam39'
ID538340
Institutional Source Beutler Lab
Gene Symbol Adam39
Ensembl Gene ENSMUSG00000054033
Gene Namea disintegrin and metallopeptidase domain 39
Synonyms1700056P18Rik, testase 9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6896 (G1)
Quality Score200.009
Status Not validated
Chromosome8
Chromosomal Location40822990-40827037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40824938 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 122 (N122I)
Ref Sequence ENSEMBL: ENSMUSP00000065783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066814]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066814
AA Change: N122I

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065783
Gene: ENSMUSG00000054033
AA Change: N122I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 178 1.3e-19 PFAM
Pfam:Reprolysin_5 219 398 2.2e-18 PFAM
Pfam:Reprolysin_4 219 406 6.8e-16 PFAM
Pfam:Reprolysin 221 410 1.3e-43 PFAM
Pfam:Reprolysin_2 238 399 2.6e-12 PFAM
Pfam:Reprolysin_3 246 366 1.2e-17 PFAM
DISIN 428 503 3.97e-37 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 702 724 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Adam39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam39 APN 8 40826746 missense possibly damaging 0.53
IGL01350:Adam39 APN 8 40825839 nonsense probably null
IGL02237:Adam39 APN 8 40825445 missense probably benign 0.39
IGL02688:Adam39 APN 8 40826320 missense probably benign 0.00
IGL02890:Adam39 APN 8 40825153 missense probably benign 0.03
IGL03071:Adam39 APN 8 40825067 missense probably benign 0.08
IGL03145:Adam39 APN 8 40824658 missense probably benign 0.00
R0083:Adam39 UTSW 8 40825078 missense probably damaging 0.98
R0086:Adam39 UTSW 8 40826360 missense possibly damaging 0.64
R0546:Adam39 UTSW 8 40826431 missense probably damaging 1.00
R0548:Adam39 UTSW 8 40826467 missense probably damaging 1.00
R1489:Adam39 UTSW 8 40824994 missense possibly damaging 0.49
R1643:Adam39 UTSW 8 40826486 missense possibly damaging 0.83
R1756:Adam39 UTSW 8 40825324 missense probably damaging 0.99
R2081:Adam39 UTSW 8 40826842 makesense probably null
R4510:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4511:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4612:Adam39 UTSW 8 40825921 missense probably damaging 0.96
R4673:Adam39 UTSW 8 40824731 missense probably benign 0.37
R4704:Adam39 UTSW 8 40825796 missense probably benign
R4978:Adam39 UTSW 8 40825337 missense possibly damaging 0.49
R5116:Adam39 UTSW 8 40825001 missense probably damaging 1.00
R5269:Adam39 UTSW 8 40825981 missense probably benign 0.01
R5710:Adam39 UTSW 8 40824647 missense probably benign 0.05
R5971:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6067:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6078:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6180:Adam39 UTSW 8 40826573 missense probably benign 0.03
R6358:Adam39 UTSW 8 40826681 missense probably benign 0.16
R6699:Adam39 UTSW 8 40826657 missense probably benign 0.01
R7117:Adam39 UTSW 8 40826242 missense probably damaging 1.00
R7186:Adam39 UTSW 8 40826312 missense probably damaging 1.00
R7195:Adam39 UTSW 8 40824775 nonsense probably null
R7381:Adam39 UTSW 8 40825963 missense probably damaging 1.00
R7405:Adam39 UTSW 8 40824622 missense probably benign 0.01
U15987:Adam39 UTSW 8 40824593 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCCCAGAAGTAGTGATACCC -3'
(R):5'- TGTCAATGCACATCTCATGGGG -3'

Sequencing Primer
(F):5'- CCAGAAGTAGTGATACCCTTACGG -3'
(R):5'- GCACATCTCATGGGGTATAATTCTG -3'
Posted On2018-11-06