Incidental Mutation 'R6896:Xpot'
ID538343
Institutional Source Beutler Lab
Gene Symbol Xpot
Ensembl Gene ENSMUSG00000034667
Gene Nameexportin, tRNA (nuclear export receptor for tRNAs)
Synonyms1110004L07Rik, C79645, EXPORTIN-T
MMRRC Submission
Accession Numbers

Genbank: NM_001081056; MGI: 1920442

Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121587380-121626332 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 121613485 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039810] [ENSMUST00000217865] [ENSMUST00000218004]
Predicted Effect probably null
Transcript: ENSMUST00000039810
SMART Domains Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667

DomainStartEndE-ValueType
IBN_N 21 89 1.37e-3 SMART
Pfam:Xpo1 98 248 5.1e-42 PFAM
low complexity region 386 399 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217865
Predicted Effect probably null
Transcript: ENSMUST00000218004
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Xpot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Xpot APN 10 121605644 missense probably benign
IGL01286:Xpot APN 10 121602338 missense probably benign 0.03
IGL01364:Xpot APN 10 121604494 missense probably benign 0.08
IGL01370:Xpot APN 10 121604494 missense probably benign 0.08
IGL01516:Xpot APN 10 121590222 unclassified probably null
IGL01530:Xpot APN 10 121611528 missense probably damaging 0.99
IGL02047:Xpot APN 10 121601362 unclassified probably benign
IGL02207:Xpot APN 10 121613580 missense probably damaging 1.00
IGL02340:Xpot APN 10 121615204 missense probably damaging 1.00
IGL02408:Xpot APN 10 121603165 missense probably damaging 1.00
IGL03150:Xpot APN 10 121609186 missense probably benign 0.00
IGL03210:Xpot APN 10 121615227 splice site probably benign
3-1:Xpot UTSW 10 121613359 missense probably benign 0.00
R0077:Xpot UTSW 10 121605639 missense probably benign 0.09
R1750:Xpot UTSW 10 121603027 critical splice donor site probably null
R1806:Xpot UTSW 10 121607638 splice site probably benign
R1950:Xpot UTSW 10 121619148 missense probably benign
R2227:Xpot UTSW 10 121622860 missense probably damaging 0.98
R2304:Xpot UTSW 10 121611583 missense probably benign 0.02
R3914:Xpot UTSW 10 121604538 missense possibly damaging 0.72
R4784:Xpot UTSW 10 121615063 unclassified probably null
R4884:Xpot UTSW 10 121606808 missense probably damaging 1.00
R4904:Xpot UTSW 10 121617178 missense probably benign 0.00
R5218:Xpot UTSW 10 121619138 missense probably damaging 0.99
R5361:Xpot UTSW 10 121600860 missense possibly damaging 0.71
R5651:Xpot UTSW 10 121604549 missense probably damaging 0.99
R5894:Xpot UTSW 10 121613646 missense probably damaging 1.00
R5915:Xpot UTSW 10 121615093 missense probably damaging 0.97
R6139:Xpot UTSW 10 121611708 missense probably benign 0.41
R6182:Xpot UTSW 10 121606258 missense probably damaging 1.00
R7024:Xpot UTSW 10 121602399 missense probably benign 0.35
R7146:Xpot UTSW 10 121606773 missense probably damaging 1.00
R7272:Xpot UTSW 10 121617189 critical splice acceptor site probably null
R7556:Xpot UTSW 10 121613506 missense probably benign 0.01
R7882:Xpot UTSW 10 121619091 critical splice donor site probably null
R7965:Xpot UTSW 10 121619091 critical splice donor site probably null
Z1088:Xpot UTSW 10 121601323 missense probably damaging 0.99
Z1176:Xpot UTSW 10 121617174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCATCTTATCCACAGGGTCC -3'
(R):5'- TGTGTCTAGGAGGCTCGAAG -3'

Sequencing Primer
(F):5'- CCCTTTATTTACAATCTCGAACAAGC -3'
(R):5'- GGCTCGAAGGAACACACTG -3'
Posted On2018-11-06