Incidental Mutation 'R6896:Smg8'
ID538345
Institutional Source Beutler Lab
Gene Symbol Smg8
Ensembl Gene ENSMUSG00000020495
Gene Namesmg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms1200011M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87077732-87086774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87077961 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 990 (T990A)
Ref Sequence ENSEMBL: ENSMUSP00000020801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020801] [ENSMUST00000020804] [ENSMUST00000143280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020801
AA Change: T990A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020801
Gene: ENSMUSG00000020495
AA Change: T990A

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Pfam:DUF2146 41 985 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020804
SMART Domains Protein: ENSMUSP00000020804
Gene: ENSMUSG00000061666

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:GDPD 45 204 1.2e-26 PFAM
low complexity region 206 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143280
SMART Domains Protein: ENSMUSP00000119011
Gene: ENSMUSG00000020495

DomainStartEndE-ValueType
Pfam:DUF2146 1 269 2.9e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Smg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Smg8 APN 11 87078041 missense probably damaging 0.96
IGL01591:Smg8 APN 11 87085153 missense probably damaging 1.00
IGL01844:Smg8 APN 11 87080276 missense probably damaging 1.00
IGL02634:Smg8 APN 11 87086672 missense probably benign
IGL03170:Smg8 APN 11 87086608 missense probably damaging 1.00
IGL03206:Smg8 APN 11 87085988 unclassified probably null
R0218:Smg8 UTSW 11 87086122 missense probably damaging 1.00
R0378:Smg8 UTSW 11 87080423 missense probably damaging 1.00
R0497:Smg8 UTSW 11 87086084 missense possibly damaging 0.95
R0522:Smg8 UTSW 11 87086462 missense probably benign
R0546:Smg8 UTSW 11 87083613 missense possibly damaging 0.69
R0634:Smg8 UTSW 11 87086108 missense possibly damaging 0.86
R1245:Smg8 UTSW 11 87083610 missense possibly damaging 0.91
R1710:Smg8 UTSW 11 87086287 missense probably damaging 0.98
R1726:Smg8 UTSW 11 87080613 nonsense probably null
R1747:Smg8 UTSW 11 87085303 missense possibly damaging 0.93
R1748:Smg8 UTSW 11 87085768 missense probably damaging 1.00
R1909:Smg8 UTSW 11 87080613 nonsense probably null
R1981:Smg8 UTSW 11 87085331 missense probably benign 0.00
R2356:Smg8 UTSW 11 87085728 missense probably benign 0.00
R4459:Smg8 UTSW 11 87085570 missense probably benign 0.09
R4724:Smg8 UTSW 11 87086221 missense probably benign 0.39
R4914:Smg8 UTSW 11 87080710 missense probably damaging 1.00
R5023:Smg8 UTSW 11 87086137 missense probably damaging 1.00
R5284:Smg8 UTSW 11 87080311 missense possibly damaging 0.94
R5368:Smg8 UTSW 11 87080260 missense probably benign 0.21
R5534:Smg8 UTSW 11 87085470 missense probably benign 0.06
R5689:Smg8 UTSW 11 87085123 missense probably damaging 0.98
R6651:Smg8 UTSW 11 87086546 missense probably benign 0.30
R7030:Smg8 UTSW 11 87085093 missense probably damaging 1.00
R7317:Smg8 UTSW 11 87085565 missense possibly damaging 0.76
X0028:Smg8 UTSW 11 87086122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGGGATATACTAACCTTGCTTTG -3'
(R):5'- CACCATGTCCAGTATTTTACCCAG -3'

Sequencing Primer
(F):5'- CAGGCAGCAATGATCCTTGTGTATC -3'
(R):5'- TGTCCAGTATTTTACCCAGAAAAAC -3'
Posted On2018-11-06