Incidental Mutation 'R6896:Coch'
ID538347
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51602869 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085412
AA Change: D321G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: D321G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164782
AA Change: D321G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: D321G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
R7595:Coch UTSW 12 51598233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAATTCTTTACAGCAGACACTGG -3'
(R):5'- TATGCATGTGTTCCCAGGCC -3'

Sequencing Primer
(F):5'- CACTGGTGTGAGAAAAGGAATACC -3'
(R):5'- GGTCTTAATTGCATAGGCTGGCC -3'
Posted On2018-11-06