Incidental Mutation 'R6896:Zfp641'
ID538352
Institutional Source Beutler Lab
Gene Symbol Zfp641
Ensembl Gene ENSMUSG00000022987
Gene Namezinc finger protein 641
Synonyms9930016F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98285585-98296161 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 98293803 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000133212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023722] [ENSMUST00000169721]
Predicted Effect probably benign
Transcript: ENSMUST00000023722
AA Change: M1L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023722
Gene: ENSMUSG00000022987
AA Change: M1L

DomainStartEndE-ValueType
KRAB 91 142 2.16e-10 SMART
ZnF_C2H2 236 258 1.58e-3 SMART
ZnF_C2H2 264 286 1.67e-2 SMART
ZnF_C2H2 292 314 1.33e-1 SMART
ZnF_C2H2 342 364 8.94e-3 SMART
ZnF_C2H2 370 392 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169721
AA Change: M1L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133212
Gene: ENSMUSG00000022987
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
KRAB 95 156 2.56e-21 SMART
ZnF_C2H2 250 272 1.58e-3 SMART
ZnF_C2H2 278 300 1.67e-2 SMART
ZnF_C2H2 306 328 1.33e-1 SMART
ZnF_C2H2 356 378 8.94e-3 SMART
ZnF_C2H2 384 406 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Other mutations in Zfp641
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Zfp641 APN 15 98291185 missense possibly damaging 0.85
IGL03092:Zfp641 APN 15 98290516 missense probably damaging 1.00
IGL03191:Zfp641 APN 15 98288687 missense probably damaging 0.98
R0079:Zfp641 UTSW 15 98289089 missense probably benign 0.28
R0243:Zfp641 UTSW 15 98289127 missense possibly damaging 0.82
R0487:Zfp641 UTSW 15 98289179 missense probably benign
R2092:Zfp641 UTSW 15 98293712 missense probably benign
R3415:Zfp641 UTSW 15 98290540 missense probably benign 0.28
R4834:Zfp641 UTSW 15 98293704 missense probably damaging 1.00
R4851:Zfp641 UTSW 15 98288717 missense probably damaging 0.99
R5776:Zfp641 UTSW 15 98289010 missense probably damaging 1.00
R6057:Zfp641 UTSW 15 98292935 missense probably benign 0.00
R6958:Zfp641 UTSW 15 98292951 missense possibly damaging 0.46
R6969:Zfp641 UTSW 15 98290567 missense possibly damaging 0.46
Z1177:Zfp641 UTSW 15 98288535
Predicted Primers PCR Primer
(F):5'- GACAGTGGCTCGTCTTCAAGAC -3'
(R):5'- AACAGGGACTTGACTGTGTGG -3'

Sequencing Primer
(F):5'- TCGTCTTCAAGACCACAGTGAAGG -3'
(R):5'- TGGAAAGCTTGGCTCACAC -3'
Posted On2018-11-06