Incidental Mutation 'R6896:Akap8'
ID538354
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene NameA kinase (PRKA) anchor protein 8
Synonyms1200016A02Rik, AKAP95
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32303676-32321153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32317331 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699] [ENSMUST00000050214]
Predicted Effect probably benign
Transcript: ENSMUST00000002699
AA Change: N36S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: N36S

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050214
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32317280 missense probably damaging 1.00
IGL01450:Akap8 APN 17 32315687 missense probably damaging 1.00
IGL02002:Akap8 APN 17 32309496 missense probably damaging 1.00
IGL02223:Akap8 APN 17 32316647 missense probably damaging 1.00
IGL02315:Akap8 APN 17 32305501 missense probably benign 0.01
IGL03404:Akap8 APN 17 32312276 splice site probably benign
R0310:Akap8 UTSW 17 32316260 missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32317292 missense probably benign 0.28
R1795:Akap8 UTSW 17 32315477 missense probably damaging 1.00
R1992:Akap8 UTSW 17 32316612 missense probably damaging 0.99
R2571:Akap8 UTSW 17 32315455 missense probably damaging 1.00
R2918:Akap8 UTSW 17 32305648 missense probably benign 0.01
R3423:Akap8 UTSW 17 32316455 missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32317839 unclassified probably benign
R4077:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4078:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4379:Akap8 UTSW 17 32306560 missense probably damaging 0.99
R4756:Akap8 UTSW 17 32316210 missense probably damaging 0.98
R4819:Akap8 UTSW 17 32312305 missense probably damaging 1.00
R5091:Akap8 UTSW 17 32316234 missense probably benign 0.05
R5761:Akap8 UTSW 17 32317185 missense possibly damaging 0.56
R7138:Akap8 UTSW 17 32316541 missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32316575 missense possibly damaging 0.92
X0020:Akap8 UTSW 17 32315750 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAACATGTCCAAACGTTGATTGATC -3'
(R):5'- ACTACAATCTGTGGCCACCTG -3'

Sequencing Primer
(F):5'- CCAAACGTTGATTGATCTTGGC -3'
(R):5'- GTCTCTCTGGTCTTGATCACATGTG -3'
Posted On2018-11-06