Incidental Mutation 'R6896:Pcdhb3'
ID538356
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37301212 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 77 (L77P)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051754
AA Change: L77P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: L77P

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37301581 missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37301467 missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37301710 missense probably benign 0.01
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37302512 missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37302959 missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37301921 missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37302929 missense probably benign
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCAGAGAGGAAAGCTTTC -3'
(R):5'- CATTTTCAAAGAACTCCGGGG -3'

Sequencing Primer
(F):5'- CCAGAGAGGAAAGCTTTCTTAAAC -3'
(R):5'- CCGGGGCATGGTCATTTACATC -3'
Posted On2018-11-06