Incidental Mutation 'R6896:Naaladl1'
ID538358
Institutional Source Beutler Lab
Gene Symbol Naaladl1
Ensembl Gene ENSMUSG00000054999
Gene NameN-acetylated alpha-linked acidic dipeptidase-like 1
SynonymsLOC381204
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6105782-6115792 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 6109305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044451]
Predicted Effect probably null
Transcript: ENSMUST00000044451
SMART Domains Protein: ENSMUSP00000044231
Gene: ENSMUSG00000054999

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:PA 163 256 3e-12 PFAM
Pfam:Peptidase_M28 353 564 1.3e-22 PFAM
low complexity region 579 592 N/A INTRINSIC
Pfam:TFR_dimer 621 740 4.5e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,683,313 L454P probably damaging Het
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Naaladl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Naaladl1 APN 19 6109631 splice site probably null
IGL01905:Naaladl1 APN 19 6115547 missense possibly damaging 0.79
IGL02491:Naaladl1 APN 19 6109718 missense possibly damaging 0.82
IGL03135:Naaladl1 APN 19 6112356 missense probably benign 0.06
IGL03143:Naaladl1 APN 19 6114866 missense possibly damaging 0.79
IGL03340:Naaladl1 APN 19 6106199 missense possibly damaging 0.63
PIT4466001:Naaladl1 UTSW 19 6114633 missense possibly damaging 0.89
R0102:Naaladl1 UTSW 19 6112504 missense probably damaging 1.00
R0102:Naaladl1 UTSW 19 6112504 missense probably damaging 1.00
R0734:Naaladl1 UTSW 19 6112874 critical splice acceptor site probably null
R2291:Naaladl1 UTSW 19 6106195 missense probably benign
R3805:Naaladl1 UTSW 19 6114865 missense probably benign 0.00
R4414:Naaladl1 UTSW 19 6115551 missense probably damaging 1.00
R4694:Naaladl1 UTSW 19 6108890 missense probably damaging 1.00
R5819:Naaladl1 UTSW 19 6109654 missense possibly damaging 0.83
R6103:Naaladl1 UTSW 19 6108713 missense probably damaging 0.99
R6141:Naaladl1 UTSW 19 6109755 critical splice donor site probably null
R6950:Naaladl1 UTSW 19 6105981 missense probably damaging 1.00
R6995:Naaladl1 UTSW 19 6115548 missense possibly damaging 0.79
R7130:Naaladl1 UTSW 19 6105988 missense probably benign 0.03
R7810:Naaladl1 UTSW 19 6109664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAAAGGAAGTGGCCC -3'
(R):5'- CCAGGACATTGGAAGAGGTC -3'

Sequencing Primer
(F):5'- TCCCAATTCAGCTACTACATGCTG -3'
(R):5'- ATTGGAAGAGGTCCTCAGCTCC -3'
Posted On2018-11-06