Incidental Mutation 'R6897:Rapgef1'
ID538363
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6897 (G1)
Quality Score184.009
Status Validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29702502 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 502 (D502G)
Ref Sequence ENSEMBL: ENSMUSP00000099936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect probably damaging
Transcript: ENSMUST00000091146
AA Change: D464G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: D464G

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095087
AA Change: D502G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: D502G

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102872
AA Change: D502G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: D502G

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147488
AA Change: D7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844
AA Change: D7G

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
RasGEFN 253 395 8.04e-37 SMART
RasGEF 402 631 5.85e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147755
AA Change: D464G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: D464G

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,165 Q110L possibly damaging Het
4930579F01Rik T C 3: 138,183,773 I28V possibly damaging Het
Adamts2 A T 11: 50,737,164 probably null Het
Adgrg1 T C 8: 95,002,498 F17L probably benign Het
Aldob A G 4: 49,539,789 L183P probably damaging Het
Alg5 T C 3: 54,748,642 C270R probably benign Het
Anxa4 T A 6: 86,743,178 probably null Het
Armc2 C A 10: 41,993,229 probably null Het
Atrnl1 A G 19: 58,042,368 N1314S probably benign Het
Bbs7 T A 3: 36,598,311 E331V probably benign Het
Bmper T A 9: 23,373,929 V258E probably benign Het
Catspere2 A T 1: 178,111,573 I671F possibly damaging Het
Cd101 A G 3: 101,013,060 S508P probably damaging Het
Cd177 C T 7: 24,745,074 R694H probably benign Het
Clptm1 C A 7: 19,635,826 Q386H possibly damaging Het
Cnrip1 A G 11: 17,054,705 Y85C probably damaging Het
Dclk2 A T 3: 86,831,763 F310I probably benign Het
Dmxl1 A G 18: 49,851,495 K186R probably null Het
Dmxl1 C A 18: 49,863,057 Q417K possibly damaging Het
Eloa T C 4: 136,012,909 D67G possibly damaging Het
Elovl4 T C 9: 83,783,225 I103V probably benign Het
Gabpa C G 16: 84,860,473 A412G probably benign Het
Gldn T A 9: 54,334,874 probably null Het
Ino80d A T 1: 63,065,834 I361N probably damaging Het
Kalrn G A 16: 33,975,703 T1234M probably damaging Het
Kcnk13 T A 12: 100,061,767 M367K probably benign Het
Klrd1 G A 6: 129,593,505 R8Q possibly damaging Het
Kmt2a T C 9: 44,847,645 N969S probably benign Het
Lgi4 A G 7: 31,068,890 D438G probably benign Het
Lig1 T C 7: 13,305,914 L684P probably damaging Het
Lrp2 T C 2: 69,510,502 M1010V probably benign Het
Magi3 C A 3: 104,089,557 R224I probably damaging Het
Mier2 T C 10: 79,544,739 N277S probably damaging Het
Morn1 A G 4: 155,086,655 H17R probably benign Het
Nf2 A T 11: 4,799,878 S265T probably damaging Het
Olfr1029 A G 2: 85,975,356 T38A possibly damaging Het
Olfr1058 G A 2: 86,385,680 T246I possibly damaging Het
Palb2 A G 7: 122,127,047 probably null Het
Pdzd2 C T 15: 12,385,865 V940M probably damaging Het
Phldb2 T C 16: 45,777,775 K850E probably damaging Het
Pitx1 G A 13: 55,828,522 T108M probably damaging Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Pomp T A 5: 147,875,503 M133K possibly damaging Het
Prex1 T C 2: 166,581,993 E993G probably damaging Het
Prrc2c C A 1: 162,705,506 probably benign Het
Pwp2 C A 10: 78,172,083 Q879H probably damaging Het
Rab26 G A 17: 24,529,792 T245I probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema5a T A 15: 32,550,275 D153E probably benign Het
Sez6 C G 11: 77,953,559 H69Q probably damaging Het
Sgsm3 A T 15: 81,008,894 T391S probably benign Het
Sh3rf2 T C 18: 42,101,605 V151A possibly damaging Het
Socs1 G T 16: 10,784,402 A157E probably benign Het
Sptbn4 C A 7: 27,371,950 V346L possibly damaging Het
Srgap1 T A 10: 121,785,618 H990L probably damaging Het
Tbc1d9 G T 8: 83,166,180 G36W probably damaging Het
Tbk1 T C 10: 121,559,877 E437G probably benign Het
Tns3 A G 11: 8,531,743 L203P probably damaging Het
Tspoap1 A T 11: 87,765,812 K283M probably damaging Het
Ttyh1 C T 7: 4,124,650 probably benign Het
Ufd1 T A 16: 18,827,100 I254N probably benign Het
Ugdh T G 5: 65,427,433 T49P probably benign Het
Vav3 T C 3: 109,527,494 L447P probably damaging Het
Vmn1r216 A T 13: 23,099,275 K43* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r13 A G 5: 109,158,149 I521T possibly damaging Het
Wdfy3 T C 5: 101,844,066 T3470A probably benign Het
Wdhd1 T A 14: 47,248,130 K791N probably damaging Het
Xirp2 A G 2: 67,508,567 D384G probably damaging Het
Zfp512b C T 2: 181,590,480 R86Q probably damaging Het
Zfp735 A C 11: 73,711,054 I275L probably benign Het
Zfp957 A T 14: 79,213,904 S152T probably damaging Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
R7956:Rapgef1 UTSW 2 29699015 missense probably benign 0.03
R8161:Rapgef1 UTSW 2 29679198 missense probably benign 0.08
R8162:Rapgef1 UTSW 2 29735999 missense probably damaging 0.99
R8372:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
R8373:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGAATCTGGGCCTCCATTTC -3'
(R):5'- CACAGTGTGCTCACAGAGAG -3'

Sequencing Primer
(F):5'- GGCCACCCTTTCCAGCTG -3'
(R):5'- CAGAGAACTTACTGTGCTTGTTC -3'
Posted On2018-11-06