Incidental Mutation 'R6897:Magi3'
ID 538374
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 044991-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R6897 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103996873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Isoleucine at position 224 (R224I)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: R224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: R224I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: R224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: R224I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: R224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: R224I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 137,889,534 (GRCm39) I28V possibly damaging Het
Adamts2 A T 11: 50,627,991 (GRCm39) probably null Het
Adgrg1 T C 8: 95,729,126 (GRCm39) F17L probably benign Het
Aldob A G 4: 49,539,789 (GRCm39) L183P probably damaging Het
Alg5 T C 3: 54,656,063 (GRCm39) C270R probably benign Het
Anxa4 T A 6: 86,720,160 (GRCm39) probably null Het
Armc2 C A 10: 41,869,225 (GRCm39) probably null Het
Atrnl1 A G 19: 58,030,800 (GRCm39) N1314S probably benign Het
Bbs7 T A 3: 36,652,460 (GRCm39) E331V probably benign Het
Bmper T A 9: 23,285,225 (GRCm39) V258E probably benign Het
Catspere2 A T 1: 177,939,139 (GRCm39) I671F possibly damaging Het
Cd101 A G 3: 100,920,376 (GRCm39) S508P probably damaging Het
Cd177 C T 7: 24,444,499 (GRCm39) R694H probably benign Het
Clptm1 C A 7: 19,369,751 (GRCm39) Q386H possibly damaging Het
Cnrip1 A G 11: 17,004,705 (GRCm39) Y85C probably damaging Het
Dclk2 A T 3: 86,739,070 (GRCm39) F310I probably benign Het
Dmxl1 A G 18: 49,984,562 (GRCm39) K186R probably null Het
Dmxl1 C A 18: 49,996,124 (GRCm39) Q417K possibly damaging Het
Eloa T C 4: 135,740,220 (GRCm39) D67G possibly damaging Het
Elovl4 T C 9: 83,665,278 (GRCm39) I103V probably benign Het
Gabpa C G 16: 84,657,361 (GRCm39) A412G probably benign Het
Gldn T A 9: 54,242,158 (GRCm39) probably null Het
Ino80d A T 1: 63,104,993 (GRCm39) I361N probably damaging Het
Kalrn G A 16: 33,796,073 (GRCm39) T1234M probably damaging Het
Kcnk13 T A 12: 100,028,026 (GRCm39) M367K probably benign Het
Klrd1 G A 6: 129,570,468 (GRCm39) R8Q possibly damaging Het
Kmt2a T C 9: 44,758,942 (GRCm39) N969S probably benign Het
Lgi4 A G 7: 30,768,315 (GRCm39) D438G probably benign Het
Lig1 T C 7: 13,039,840 (GRCm39) L684P probably damaging Het
Lrp2 T C 2: 69,340,846 (GRCm39) M1010V probably benign Het
Mier2 T C 10: 79,380,573 (GRCm39) N277S probably damaging Het
Morn1 A G 4: 155,171,112 (GRCm39) H17R probably benign Het
Nf2 A T 11: 4,749,878 (GRCm39) S265T probably damaging Het
Or5m11b A G 2: 85,805,700 (GRCm39) T38A possibly damaging Het
Or8k24 G A 2: 86,216,024 (GRCm39) T246I possibly damaging Het
Palb2 A G 7: 121,726,270 (GRCm39) probably null Het
Pdzd2 C T 15: 12,385,951 (GRCm39) V940M probably damaging Het
Phldb2 T C 16: 45,598,138 (GRCm39) K850E probably damaging Het
Pitx1 G A 13: 55,976,335 (GRCm39) T108M probably damaging Het
Polr2a C T 11: 69,626,787 (GRCm39) A1516T probably benign Het
Pomp T A 5: 147,812,313 (GRCm39) M133K possibly damaging Het
Prex1 T C 2: 166,423,913 (GRCm39) E993G probably damaging Het
Prrc2c C A 1: 162,533,075 (GRCm39) probably benign Het
Pwp2 C A 10: 78,007,917 (GRCm39) Q879H probably damaging Het
Rab26 G A 17: 24,748,766 (GRCm39) T245I probably damaging Het
Rapgef1 A G 2: 29,592,514 (GRCm39) D502G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Sema5a T A 15: 32,550,421 (GRCm39) D153E probably benign Het
Sez6 C G 11: 77,844,385 (GRCm39) H69Q probably damaging Het
Sgsm3 A T 15: 80,893,095 (GRCm39) T391S probably benign Het
Sh3rf2 T C 18: 42,234,670 (GRCm39) V151A possibly damaging Het
Socs1 G T 16: 10,602,266 (GRCm39) A157E probably benign Het
Spmip4 T A 6: 50,566,145 (GRCm39) Q110L possibly damaging Het
Sptbn4 C A 7: 27,071,375 (GRCm39) V346L possibly damaging Het
Srgap1 T A 10: 121,621,523 (GRCm39) H990L probably damaging Het
Tbc1d9 G T 8: 83,892,809 (GRCm39) G36W probably damaging Het
Tbk1 T C 10: 121,395,782 (GRCm39) E437G probably benign Het
Tns3 A G 11: 8,481,743 (GRCm39) L203P probably damaging Het
Tspoap1 A T 11: 87,656,638 (GRCm39) K283M probably damaging Het
Ttyh1 C T 7: 4,127,649 (GRCm39) probably benign Het
Ufd1 T A 16: 18,645,850 (GRCm39) I254N probably benign Het
Ugdh T G 5: 65,584,776 (GRCm39) T49P probably benign Het
Vav3 T C 3: 109,434,810 (GRCm39) L447P probably damaging Het
Vmn1r216 A T 13: 23,283,445 (GRCm39) K43* probably null Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r13 A G 5: 109,306,015 (GRCm39) I521T possibly damaging Het
Wdfy3 T C 5: 101,991,932 (GRCm39) T3470A probably benign Het
Wdhd1 T A 14: 47,485,587 (GRCm39) K791N probably damaging Het
Xirp2 A G 2: 67,338,911 (GRCm39) D384G probably damaging Het
Zfp512b C T 2: 181,232,273 (GRCm39) R86Q probably damaging Het
Zfp735 A C 11: 73,601,880 (GRCm39) I275L probably benign Het
Zfp957 A T 14: 79,451,344 (GRCm39) S152T probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATTAGAATCCTAGCACCTGC -3'
(R):5'- TTTTAGTCAGTGACAGAGGCATTC -3'

Sequencing Primer
(F):5'- GCACCTGCTCTGCATATAGTTCAAG -3'
(R):5'- GTCAGTGACAGAGGCATTCTTTAAGC -3'
Posted On 2018-11-06