Incidental Mutation 'R6897:Pwp2'
ID538402
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R6897 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78172083 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 879 (Q879H)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001242] [ENSMUST00000042556] [ENSMUST00000219120]
Predicted Effect probably benign
Transcript: ENSMUST00000001242
SMART Domains Protein: ENSMUSP00000001242
Gene: ENSMUSG00000053329

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
SCOP:d1cf9a1 40 239 3e-21 SMART
PDB:1OY1|D 42 263 2e-58 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000042556
AA Change: Q879H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: Q879H

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219120
Predicted Effect probably benign
Transcript: ENSMUST00000220359
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,165 Q110L possibly damaging Het
4930579F01Rik T C 3: 138,183,773 I28V possibly damaging Het
Adamts2 A T 11: 50,737,164 probably null Het
Adgrg1 T C 8: 95,002,498 F17L probably benign Het
Aldob A G 4: 49,539,789 L183P probably damaging Het
Alg5 T C 3: 54,748,642 C270R probably benign Het
Anxa4 T A 6: 86,743,178 probably null Het
Armc2 C A 10: 41,993,229 probably null Het
Atrnl1 A G 19: 58,042,368 N1314S probably benign Het
Bbs7 T A 3: 36,598,311 E331V probably benign Het
Bmper T A 9: 23,373,929 V258E probably benign Het
Catspere2 A T 1: 178,111,573 I671F possibly damaging Het
Cd101 A G 3: 101,013,060 S508P probably damaging Het
Cd177 C T 7: 24,745,074 R694H probably benign Het
Clptm1 C A 7: 19,635,826 Q386H possibly damaging Het
Cnrip1 A G 11: 17,054,705 Y85C probably damaging Het
Dclk2 A T 3: 86,831,763 F310I probably benign Het
Dmxl1 A G 18: 49,851,495 K186R probably null Het
Dmxl1 C A 18: 49,863,057 Q417K possibly damaging Het
Eloa T C 4: 136,012,909 D67G possibly damaging Het
Elovl4 T C 9: 83,783,225 I103V probably benign Het
Gabpa C G 16: 84,860,473 A412G probably benign Het
Gldn T A 9: 54,334,874 probably null Het
Ino80d A T 1: 63,065,834 I361N probably damaging Het
Kalrn G A 16: 33,975,703 T1234M probably damaging Het
Kcnk13 T A 12: 100,061,767 M367K probably benign Het
Klrd1 G A 6: 129,593,505 R8Q possibly damaging Het
Kmt2a T C 9: 44,847,645 N969S probably benign Het
Lgi4 A G 7: 31,068,890 D438G probably benign Het
Lig1 T C 7: 13,305,914 L684P probably damaging Het
Lrp2 T C 2: 69,510,502 M1010V probably benign Het
Magi3 C A 3: 104,089,557 R224I probably damaging Het
Mier2 T C 10: 79,544,739 N277S probably damaging Het
Morn1 A G 4: 155,086,655 H17R probably benign Het
Nf2 A T 11: 4,799,878 S265T probably damaging Het
Olfr1029 A G 2: 85,975,356 T38A possibly damaging Het
Olfr1058 G A 2: 86,385,680 T246I possibly damaging Het
Palb2 A G 7: 122,127,047 probably null Het
Pdzd2 C T 15: 12,385,865 V940M probably damaging Het
Phldb2 T C 16: 45,777,775 K850E probably damaging Het
Pitx1 G A 13: 55,828,522 T108M probably damaging Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Pomp T A 5: 147,875,503 M133K possibly damaging Het
Prex1 T C 2: 166,581,993 E993G probably damaging Het
Prrc2c C A 1: 162,705,506 probably benign Het
Rab26 G A 17: 24,529,792 T245I probably damaging Het
Rapgef1 A G 2: 29,702,502 D502G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema5a T A 15: 32,550,275 D153E probably benign Het
Sez6 C G 11: 77,953,559 H69Q probably damaging Het
Sgsm3 A T 15: 81,008,894 T391S probably benign Het
Sh3rf2 T C 18: 42,101,605 V151A possibly damaging Het
Socs1 G T 16: 10,784,402 A157E probably benign Het
Sptbn4 C A 7: 27,371,950 V346L possibly damaging Het
Srgap1 T A 10: 121,785,618 H990L probably damaging Het
Tbc1d9 G T 8: 83,166,180 G36W probably damaging Het
Tbk1 T C 10: 121,559,877 E437G probably benign Het
Tns3 A G 11: 8,531,743 L203P probably damaging Het
Tspoap1 A T 11: 87,765,812 K283M probably damaging Het
Ttyh1 C T 7: 4,124,650 probably benign Het
Ufd1 T A 16: 18,827,100 I254N probably benign Het
Ugdh T G 5: 65,427,433 T49P probably benign Het
Vav3 T C 3: 109,527,494 L447P probably damaging Het
Vmn1r216 A T 13: 23,099,275 K43* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r13 A G 5: 109,158,149 I521T possibly damaging Het
Wdfy3 T C 5: 101,844,066 T3470A probably benign Het
Wdhd1 T A 14: 47,248,130 K791N probably damaging Het
Xirp2 A G 2: 67,508,567 D384G probably damaging Het
Zfp512b C T 2: 181,590,480 R86Q probably damaging Het
Zfp735 A C 11: 73,711,054 I275L probably benign Het
Zfp957 A T 14: 79,213,904 S152T probably damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R2967:Pwp2 UTSW 10 78182698 missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78183006 missense probably benign 0.00
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 intron probably null
R7060:Pwp2 UTSW 10 78173250 intron probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7367:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACAGTGGTTTCATCTCCAG -3'
(R):5'- CAGTGGAATGCCTCTGTAATGG -3'

Sequencing Primer
(F):5'- GGTTTCATCTCCAGCCAATCAGG -3'
(R):5'- ATGCCTCTGTAATGGAAGGGCC -3'
Posted On2018-11-06