Incidental Mutation 'R6897:Zfp735'
ID538411
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6897 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73711054 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 275 (I275L)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably benign
Transcript: ENSMUST00000080407
AA Change: I275L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: I275L

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,165 Q110L possibly damaging Het
4930579F01Rik T C 3: 138,183,773 I28V possibly damaging Het
Adamts2 A T 11: 50,737,164 probably null Het
Adgrg1 T C 8: 95,002,498 F17L probably benign Het
Aldob A G 4: 49,539,789 L183P probably damaging Het
Alg5 T C 3: 54,748,642 C270R probably benign Het
Anxa4 T A 6: 86,743,178 probably null Het
Armc2 C A 10: 41,993,229 probably null Het
Atrnl1 A G 19: 58,042,368 N1314S probably benign Het
Bbs7 T A 3: 36,598,311 E331V probably benign Het
Bmper T A 9: 23,373,929 V258E probably benign Het
Catspere2 A T 1: 178,111,573 I671F possibly damaging Het
Cd101 A G 3: 101,013,060 S508P probably damaging Het
Cd177 C T 7: 24,745,074 R694H probably benign Het
Clptm1 C A 7: 19,635,826 Q386H possibly damaging Het
Cnrip1 A G 11: 17,054,705 Y85C probably damaging Het
Dclk2 A T 3: 86,831,763 F310I probably benign Het
Dmxl1 A G 18: 49,851,495 K186R probably null Het
Dmxl1 C A 18: 49,863,057 Q417K possibly damaging Het
Eloa T C 4: 136,012,909 D67G possibly damaging Het
Elovl4 T C 9: 83,783,225 I103V probably benign Het
Gabpa C G 16: 84,860,473 A412G probably benign Het
Gldn T A 9: 54,334,874 probably null Het
Ino80d A T 1: 63,065,834 I361N probably damaging Het
Kalrn G A 16: 33,975,703 T1234M probably damaging Het
Kcnk13 T A 12: 100,061,767 M367K probably benign Het
Klrd1 G A 6: 129,593,505 R8Q possibly damaging Het
Kmt2a T C 9: 44,847,645 N969S probably benign Het
Lgi4 A G 7: 31,068,890 D438G probably benign Het
Lig1 T C 7: 13,305,914 L684P probably damaging Het
Lrp2 T C 2: 69,510,502 M1010V probably benign Het
Magi3 C A 3: 104,089,557 R224I probably damaging Het
Mier2 T C 10: 79,544,739 N277S probably damaging Het
Morn1 A G 4: 155,086,655 H17R probably benign Het
Nf2 A T 11: 4,799,878 S265T probably damaging Het
Olfr1029 A G 2: 85,975,356 T38A possibly damaging Het
Olfr1058 G A 2: 86,385,680 T246I possibly damaging Het
Palb2 A G 7: 122,127,047 probably null Het
Pdzd2 C T 15: 12,385,865 V940M probably damaging Het
Phldb2 T C 16: 45,777,775 K850E probably damaging Het
Pitx1 G A 13: 55,828,522 T108M probably damaging Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Pomp T A 5: 147,875,503 M133K possibly damaging Het
Prex1 T C 2: 166,581,993 E993G probably damaging Het
Prrc2c C A 1: 162,705,506 probably benign Het
Pwp2 C A 10: 78,172,083 Q879H probably damaging Het
Rab26 G A 17: 24,529,792 T245I probably damaging Het
Rapgef1 A G 2: 29,702,502 D502G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema5a T A 15: 32,550,275 D153E probably benign Het
Sez6 C G 11: 77,953,559 H69Q probably damaging Het
Sgsm3 A T 15: 81,008,894 T391S probably benign Het
Sh3rf2 T C 18: 42,101,605 V151A possibly damaging Het
Socs1 G T 16: 10,784,402 A157E probably benign Het
Sptbn4 C A 7: 27,371,950 V346L possibly damaging Het
Srgap1 T A 10: 121,785,618 H990L probably damaging Het
Tbc1d9 G T 8: 83,166,180 G36W probably damaging Het
Tbk1 T C 10: 121,559,877 E437G probably benign Het
Tns3 A G 11: 8,531,743 L203P probably damaging Het
Tspoap1 A T 11: 87,765,812 K283M probably damaging Het
Ttyh1 C T 7: 4,124,650 probably benign Het
Ufd1 T A 16: 18,827,100 I254N probably benign Het
Ugdh T G 5: 65,427,433 T49P probably benign Het
Vav3 T C 3: 109,527,494 L447P probably damaging Het
Vmn1r216 A T 13: 23,099,275 K43* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r13 A G 5: 109,158,149 I521T possibly damaging Het
Wdfy3 T C 5: 101,844,066 T3470A probably benign Het
Wdhd1 T A 14: 47,248,130 K791N probably damaging Het
Xirp2 A G 2: 67,508,567 D384G probably damaging Het
Zfp512b C T 2: 181,590,480 R86Q probably damaging Het
Zfp957 A T 14: 79,213,904 S152T probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGGTGAATAAACACACTTCTCTG -3'
(R):5'- TAGACCTAGCCTGTCTACTATCATG -3'

Sequencing Primer
(F):5'- ACACACTTCTCTGAAGCATTTAC -3'
(R):5'- GAATTGTTTCATGATGAGAATC -3'
Posted On2018-11-06