Mutagenetix > Incidental Mutations

Incidental Mutation 'R6897:Sez6'

538412

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6897 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 77953559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 69 (H69Q)

Ref Sequence

ENSEMBL: ENSMUSP00000091532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000646
AA Change: H69Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: H69Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093995
AA Change: H69Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: H69Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151982

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	A	6: 50,589,165	Q110L	possibly damaging	Het
4930579F01Rik	T	C	3: 138,183,773	I28V	possibly damaging	Het
Adamts2	A	T	11: 50,737,164		probably null	Het
Adgrg1	T	C	8: 95,002,498	F17L	probably benign	Het
Aldob	A	G	4: 49,539,789	L183P	probably damaging	Het
Alg5	T	C	3: 54,748,642	C270R	probably benign	Het
Anxa4	T	A	6: 86,743,178		probably null	Het
Armc2	C	A	10: 41,993,229		probably null	Het
Atrnl1	A	G	19: 58,042,368	N1314S	probably benign	Het
Bbs7	T	A	3: 36,598,311	E331V	probably benign	Het
Bmper	T	A	9: 23,373,929	V258E	probably benign	Het
Catspere2	A	T	1: 178,111,573	I671F	possibly damaging	Het
Cd101	A	G	3: 101,013,060	S508P	probably damaging	Het
Cd177	C	T	7: 24,745,074	R694H	probably benign	Het
Clptm1	C	A	7: 19,635,826	Q386H	possibly damaging	Het
Cnrip1	A	G	11: 17,054,705	Y85C	probably damaging	Het
Dclk2	A	T	3: 86,831,763	F310I	probably benign	Het
Dmxl1	A	G	18: 49,851,495	K186R	probably null	Het
Dmxl1	C	A	18: 49,863,057	Q417K	possibly damaging	Het
Eloa	T	C	4: 136,012,909	D67G	possibly damaging	Het
Elovl4	T	C	9: 83,783,225	I103V	probably benign	Het
Gabpa	C	G	16: 84,860,473	A412G	probably benign	Het
Gldn	T	A	9: 54,334,874		probably null	Het
Ino80d	A	T	1: 63,065,834	I361N	probably damaging	Het
Kalrn	G	A	16: 33,975,703	T1234M	probably damaging	Het
Kcnk13	T	A	12: 100,061,767	M367K	probably benign	Het
Klrd1	G	A	6: 129,593,505	R8Q	possibly damaging	Het
Kmt2a	T	C	9: 44,847,645	N969S	probably benign	Het
Lgi4	A	G	7: 31,068,890	D438G	probably benign	Het
Lig1	T	C	7: 13,305,914	L684P	probably damaging	Het
Lrp2	T	C	2: 69,510,502	M1010V	probably benign	Het
Magi3	C	A	3: 104,089,557	R224I	probably damaging	Het
Mier2	T	C	10: 79,544,739	N277S	probably damaging	Het
Morn1	A	G	4: 155,086,655	H17R	probably benign	Het
Nf2	A	T	11: 4,799,878	S265T	probably damaging	Het
Olfr1029	A	G	2: 85,975,356	T38A	possibly damaging	Het
Olfr1058	G	A	2: 86,385,680	T246I	possibly damaging	Het
Palb2	A	G	7: 122,127,047		probably null	Het
Pdzd2	C	T	15: 12,385,865	V940M	probably damaging	Het
Phldb2	T	C	16: 45,777,775	K850E	probably damaging	Het
Pitx1	G	A	13: 55,828,522	T108M	probably damaging	Het
Polr2a	C	T	11: 69,735,961	A1516T	probably benign	Het
Pomp	T	A	5: 147,875,503	M133K	possibly damaging	Het
Prex1	T	C	2: 166,581,993	E993G	probably damaging	Het
Prrc2c	C	A	1: 162,705,506		probably benign	Het
Pwp2	C	A	10: 78,172,083	Q879H	probably damaging	Het
Rab26	G	A	17: 24,529,792	T245I	probably damaging	Het
Rapgef1	A	G	2: 29,702,502	D502G	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Sema5a	T	A	15: 32,550,275	D153E	probably benign	Het
Sgsm3	A	T	15: 81,008,894	T391S	probably benign	Het
Sh3rf2	T	C	18: 42,101,605	V151A	possibly damaging	Het
Socs1	G	T	16: 10,784,402	A157E	probably benign	Het
Sptbn4	C	A	7: 27,371,950	V346L	possibly damaging	Het
Srgap1	T	A	10: 121,785,618	H990L	probably damaging	Het
Tbc1d9	G	T	8: 83,166,180	G36W	probably damaging	Het
Tbk1	T	C	10: 121,559,877	E437G	probably benign	Het
Tns3	A	G	11: 8,531,743	L203P	probably damaging	Het
Tspoap1	A	T	11: 87,765,812	K283M	probably damaging	Het
Ttyh1	C	T	7: 4,124,650		probably benign	Het
Ufd1	T	A	16: 18,827,100	I254N	probably benign	Het
Ugdh	T	G	5: 65,427,433	T49P	probably benign	Het
Vav3	T	C	3: 109,527,494	L447P	probably damaging	Het
Vmn1r216	A	T	13: 23,099,275	K43*	probably null	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r13	A	G	5: 109,158,149	I521T	possibly damaging	Het
Wdfy3	T	C	5: 101,844,066	T3470A	probably benign	Het
Wdhd1	T	A	14: 47,248,130	K791N	probably damaging	Het
Xirp2	A	G	2: 67,508,567	D384G	probably damaging	Het
Zfp512b	C	T	2: 181,590,480	R86Q	probably damaging	Het
Zfp735	A	C	11: 73,711,054	I275L	probably benign	Het
Zfp957	A	T	14: 79,213,904	S152T	probably damaging	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4894:Sez6	UTSW	11	77975260	missense	probably damaging	1.00
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6126:Sez6	UTSW	11	77973804	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6910:Sez6	UTSW	11	77953869	missense	possibly damaging	0.85
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7405:Sez6	UTSW	11	77962891	missense	probably benign	0.10
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R8973:Sez6	UTSW	11	77974571	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAAGAGAGCCTCTGATCATTCATTC -3'
(R):5'- AGGTTCCAAGGTTTCTCCCTG -3'

Sequencing Primer
(F):5'- CATTCATTCTTATTTCAGGACTCTCC -3'
(R):5'- CAAGGTTTCTCCCTGGAGTG -3'

Posted On

2018-11-06