Incidental Mutation 'R6897:Sez6'
ID 538412
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Name seizure related gene 6
Synonyms D11Bhm177e, sez-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6897 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77930800-77979048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 77953559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 69 (H69Q)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
AlphaFold Q7TSK2
Predicted Effect possibly damaging
Transcript: ENSMUST00000000646
AA Change: H69Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: H69Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093995
AA Change: H69Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: H69Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T A 6: 50,589,165 Q110L possibly damaging Het
4930579F01Rik T C 3: 138,183,773 I28V possibly damaging Het
Adamts2 A T 11: 50,737,164 probably null Het
Adgrg1 T C 8: 95,002,498 F17L probably benign Het
Aldob A G 4: 49,539,789 L183P probably damaging Het
Alg5 T C 3: 54,748,642 C270R probably benign Het
Anxa4 T A 6: 86,743,178 probably null Het
Armc2 C A 10: 41,993,229 probably null Het
Atrnl1 A G 19: 58,042,368 N1314S probably benign Het
Bbs7 T A 3: 36,598,311 E331V probably benign Het
Bmper T A 9: 23,373,929 V258E probably benign Het
Catspere2 A T 1: 178,111,573 I671F possibly damaging Het
Cd101 A G 3: 101,013,060 S508P probably damaging Het
Cd177 C T 7: 24,745,074 R694H probably benign Het
Clptm1 C A 7: 19,635,826 Q386H possibly damaging Het
Cnrip1 A G 11: 17,054,705 Y85C probably damaging Het
Dclk2 A T 3: 86,831,763 F310I probably benign Het
Dmxl1 A G 18: 49,851,495 K186R probably null Het
Dmxl1 C A 18: 49,863,057 Q417K possibly damaging Het
Eloa T C 4: 136,012,909 D67G possibly damaging Het
Elovl4 T C 9: 83,783,225 I103V probably benign Het
Gabpa C G 16: 84,860,473 A412G probably benign Het
Gldn T A 9: 54,334,874 probably null Het
Ino80d A T 1: 63,065,834 I361N probably damaging Het
Kalrn G A 16: 33,975,703 T1234M probably damaging Het
Kcnk13 T A 12: 100,061,767 M367K probably benign Het
Klrd1 G A 6: 129,593,505 R8Q possibly damaging Het
Kmt2a T C 9: 44,847,645 N969S probably benign Het
Lgi4 A G 7: 31,068,890 D438G probably benign Het
Lig1 T C 7: 13,305,914 L684P probably damaging Het
Lrp2 T C 2: 69,510,502 M1010V probably benign Het
Magi3 C A 3: 104,089,557 R224I probably damaging Het
Mier2 T C 10: 79,544,739 N277S probably damaging Het
Morn1 A G 4: 155,086,655 H17R probably benign Het
Nf2 A T 11: 4,799,878 S265T probably damaging Het
Olfr1029 A G 2: 85,975,356 T38A possibly damaging Het
Olfr1058 G A 2: 86,385,680 T246I possibly damaging Het
Palb2 A G 7: 122,127,047 probably null Het
Pdzd2 C T 15: 12,385,865 V940M probably damaging Het
Phldb2 T C 16: 45,777,775 K850E probably damaging Het
Pitx1 G A 13: 55,828,522 T108M probably damaging Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Pomp T A 5: 147,875,503 M133K possibly damaging Het
Prex1 T C 2: 166,581,993 E993G probably damaging Het
Prrc2c C A 1: 162,705,506 probably benign Het
Pwp2 C A 10: 78,172,083 Q879H probably damaging Het
Rab26 G A 17: 24,529,792 T245I probably damaging Het
Rapgef1 A G 2: 29,702,502 D502G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema5a T A 15: 32,550,275 D153E probably benign Het
Sgsm3 A T 15: 81,008,894 T391S probably benign Het
Sh3rf2 T C 18: 42,101,605 V151A possibly damaging Het
Socs1 G T 16: 10,784,402 A157E probably benign Het
Sptbn4 C A 7: 27,371,950 V346L possibly damaging Het
Srgap1 T A 10: 121,785,618 H990L probably damaging Het
Tbc1d9 G T 8: 83,166,180 G36W probably damaging Het
Tbk1 T C 10: 121,559,877 E437G probably benign Het
Tns3 A G 11: 8,531,743 L203P probably damaging Het
Tspoap1 A T 11: 87,765,812 K283M probably damaging Het
Ttyh1 C T 7: 4,124,650 probably benign Het
Ufd1 T A 16: 18,827,100 I254N probably benign Het
Ugdh T G 5: 65,427,433 T49P probably benign Het
Vav3 T C 3: 109,527,494 L447P probably damaging Het
Vmn1r216 A T 13: 23,099,275 K43* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r13 A G 5: 109,158,149 I521T possibly damaging Het
Wdfy3 T C 5: 101,844,066 T3470A probably benign Het
Wdhd1 T A 14: 47,248,130 K791N probably damaging Het
Xirp2 A G 2: 67,508,567 D384G probably damaging Het
Zfp512b C T 2: 181,590,480 R86Q probably damaging Het
Zfp735 A C 11: 73,711,054 I275L probably benign Het
Zfp957 A T 14: 79,213,904 S152T probably damaging Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
velum UTSW 11 77974549 missense probably damaging 1.00
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
R7408:Sez6 UTSW 11 77953530 missense probably damaging 1.00
R7485:Sez6 UTSW 11 77973885 missense probably benign 0.01
R7592:Sez6 UTSW 11 77978050 missense probably damaging 0.99
R7778:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7793:Sez6 UTSW 11 77977600 missense probably damaging 1.00
R7818:Sez6 UTSW 11 77976902 missense probably damaging 1.00
R7824:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7980:Sez6 UTSW 11 77953842 missense probably benign 0.34
R8008:Sez6 UTSW 11 77973256 nonsense probably null
R8840:Sez6 UTSW 11 77976487 missense probably damaging 1.00
R8947:Sez6 UTSW 11 77953527 missense probably damaging 1.00
R8973:Sez6 UTSW 11 77974571 missense probably damaging 1.00
R9040:Sez6 UTSW 11 77973936 missense probably benign
R9081:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9082:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9092:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9094:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9095:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9097:Sez6 UTSW 11 77974295 missense possibly damaging 0.83
R9169:Sez6 UTSW 11 77977647 missense probably damaging 0.96
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGAGAGCCTCTGATCATTCATTC -3'
(R):5'- AGGTTCCAAGGTTTCTCCCTG -3'

Sequencing Primer
(F):5'- CATTCATTCTTATTTCAGGACTCTCC -3'
(R):5'- CAAGGTTTCTCCCTGGAGTG -3'
Posted On 2018-11-06