Incidental Mutation 'R6897:Vmn2r111'
ID 538427
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 044991-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6897 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22778032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 137,889,534 (GRCm39) I28V possibly damaging Het
Adamts2 A T 11: 50,627,991 (GRCm39) probably null Het
Adgrg1 T C 8: 95,729,126 (GRCm39) F17L probably benign Het
Aldob A G 4: 49,539,789 (GRCm39) L183P probably damaging Het
Alg5 T C 3: 54,656,063 (GRCm39) C270R probably benign Het
Anxa4 T A 6: 86,720,160 (GRCm39) probably null Het
Armc2 C A 10: 41,869,225 (GRCm39) probably null Het
Atrnl1 A G 19: 58,030,800 (GRCm39) N1314S probably benign Het
Bbs7 T A 3: 36,652,460 (GRCm39) E331V probably benign Het
Bmper T A 9: 23,285,225 (GRCm39) V258E probably benign Het
Catspere2 A T 1: 177,939,139 (GRCm39) I671F possibly damaging Het
Cd101 A G 3: 100,920,376 (GRCm39) S508P probably damaging Het
Cd177 C T 7: 24,444,499 (GRCm39) R694H probably benign Het
Clptm1 C A 7: 19,369,751 (GRCm39) Q386H possibly damaging Het
Cnrip1 A G 11: 17,004,705 (GRCm39) Y85C probably damaging Het
Dclk2 A T 3: 86,739,070 (GRCm39) F310I probably benign Het
Dmxl1 A G 18: 49,984,562 (GRCm39) K186R probably null Het
Dmxl1 C A 18: 49,996,124 (GRCm39) Q417K possibly damaging Het
Eloa T C 4: 135,740,220 (GRCm39) D67G possibly damaging Het
Elovl4 T C 9: 83,665,278 (GRCm39) I103V probably benign Het
Gabpa C G 16: 84,657,361 (GRCm39) A412G probably benign Het
Gldn T A 9: 54,242,158 (GRCm39) probably null Het
Ino80d A T 1: 63,104,993 (GRCm39) I361N probably damaging Het
Kalrn G A 16: 33,796,073 (GRCm39) T1234M probably damaging Het
Kcnk13 T A 12: 100,028,026 (GRCm39) M367K probably benign Het
Klrd1 G A 6: 129,570,468 (GRCm39) R8Q possibly damaging Het
Kmt2a T C 9: 44,758,942 (GRCm39) N969S probably benign Het
Lgi4 A G 7: 30,768,315 (GRCm39) D438G probably benign Het
Lig1 T C 7: 13,039,840 (GRCm39) L684P probably damaging Het
Lrp2 T C 2: 69,340,846 (GRCm39) M1010V probably benign Het
Magi3 C A 3: 103,996,873 (GRCm39) R224I probably damaging Het
Mier2 T C 10: 79,380,573 (GRCm39) N277S probably damaging Het
Morn1 A G 4: 155,171,112 (GRCm39) H17R probably benign Het
Nf2 A T 11: 4,749,878 (GRCm39) S265T probably damaging Het
Or5m11b A G 2: 85,805,700 (GRCm39) T38A possibly damaging Het
Or8k24 G A 2: 86,216,024 (GRCm39) T246I possibly damaging Het
Palb2 A G 7: 121,726,270 (GRCm39) probably null Het
Pdzd2 C T 15: 12,385,951 (GRCm39) V940M probably damaging Het
Phldb2 T C 16: 45,598,138 (GRCm39) K850E probably damaging Het
Pitx1 G A 13: 55,976,335 (GRCm39) T108M probably damaging Het
Polr2a C T 11: 69,626,787 (GRCm39) A1516T probably benign Het
Pomp T A 5: 147,812,313 (GRCm39) M133K possibly damaging Het
Prex1 T C 2: 166,423,913 (GRCm39) E993G probably damaging Het
Prrc2c C A 1: 162,533,075 (GRCm39) probably benign Het
Pwp2 C A 10: 78,007,917 (GRCm39) Q879H probably damaging Het
Rab26 G A 17: 24,748,766 (GRCm39) T245I probably damaging Het
Rapgef1 A G 2: 29,592,514 (GRCm39) D502G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Sema5a T A 15: 32,550,421 (GRCm39) D153E probably benign Het
Sez6 C G 11: 77,844,385 (GRCm39) H69Q probably damaging Het
Sgsm3 A T 15: 80,893,095 (GRCm39) T391S probably benign Het
Sh3rf2 T C 18: 42,234,670 (GRCm39) V151A possibly damaging Het
Socs1 G T 16: 10,602,266 (GRCm39) A157E probably benign Het
Spmip4 T A 6: 50,566,145 (GRCm39) Q110L possibly damaging Het
Sptbn4 C A 7: 27,071,375 (GRCm39) V346L possibly damaging Het
Srgap1 T A 10: 121,621,523 (GRCm39) H990L probably damaging Het
Tbc1d9 G T 8: 83,892,809 (GRCm39) G36W probably damaging Het
Tbk1 T C 10: 121,395,782 (GRCm39) E437G probably benign Het
Tns3 A G 11: 8,481,743 (GRCm39) L203P probably damaging Het
Tspoap1 A T 11: 87,656,638 (GRCm39) K283M probably damaging Het
Ttyh1 C T 7: 4,127,649 (GRCm39) probably benign Het
Ufd1 T A 16: 18,645,850 (GRCm39) I254N probably benign Het
Ugdh T G 5: 65,584,776 (GRCm39) T49P probably benign Het
Vav3 T C 3: 109,434,810 (GRCm39) L447P probably damaging Het
Vmn1r216 A T 13: 23,283,445 (GRCm39) K43* probably null Het
Vmn2r13 A G 5: 109,306,015 (GRCm39) I521T possibly damaging Het
Wdfy3 T C 5: 101,991,932 (GRCm39) T3470A probably benign Het
Wdhd1 T A 14: 47,485,587 (GRCm39) K791N probably damaging Het
Xirp2 A G 2: 67,338,911 (GRCm39) D384G probably damaging Het
Zfp512b C T 2: 181,232,273 (GRCm39) R86Q probably damaging Het
Zfp735 A C 11: 73,601,880 (GRCm39) I275L probably benign Het
Zfp957 A T 14: 79,451,344 (GRCm39) S152T probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-11-06