Mutagenetix > Incidental Mutation

Incidental Mutation 'R6897:Vmn2r111'

538427

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6897 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

97% (72/74)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	A	6: 50,589,165	Q110L	possibly damaging	Het
4930579F01Rik	T	C	3: 138,183,773	I28V	possibly damaging	Het
Adamts2	A	T	11: 50,737,164		probably null	Het
Adgrg1	T	C	8: 95,002,498	F17L	probably benign	Het
Aldob	A	G	4: 49,539,789	L183P	probably damaging	Het
Alg5	T	C	3: 54,748,642	C270R	probably benign	Het
Anxa4	T	A	6: 86,743,178		probably null	Het
Armc2	C	A	10: 41,993,229		probably null	Het
Atrnl1	A	G	19: 58,042,368	N1314S	probably benign	Het
Bbs7	T	A	3: 36,598,311	E331V	probably benign	Het
Bmper	T	A	9: 23,373,929	V258E	probably benign	Het
Catspere2	A	T	1: 178,111,573	I671F	possibly damaging	Het
Cd101	A	G	3: 101,013,060	S508P	probably damaging	Het
Cd177	C	T	7: 24,745,074	R694H	probably benign	Het
Clptm1	C	A	7: 19,635,826	Q386H	possibly damaging	Het
Cnrip1	A	G	11: 17,054,705	Y85C	probably damaging	Het
Dclk2	A	T	3: 86,831,763	F310I	probably benign	Het
Dmxl1	A	G	18: 49,851,495	K186R	probably null	Het
Dmxl1	C	A	18: 49,863,057	Q417K	possibly damaging	Het
Eloa	T	C	4: 136,012,909	D67G	possibly damaging	Het
Elovl4	T	C	9: 83,783,225	I103V	probably benign	Het
Gabpa	C	G	16: 84,860,473	A412G	probably benign	Het
Gldn	T	A	9: 54,334,874		probably null	Het
Ino80d	A	T	1: 63,065,834	I361N	probably damaging	Het
Kalrn	G	A	16: 33,975,703	T1234M	probably damaging	Het
Kcnk13	T	A	12: 100,061,767	M367K	probably benign	Het
Klrd1	G	A	6: 129,593,505	R8Q	possibly damaging	Het
Kmt2a	T	C	9: 44,847,645	N969S	probably benign	Het
Lgi4	A	G	7: 31,068,890	D438G	probably benign	Het
Lig1	T	C	7: 13,305,914	L684P	probably damaging	Het
Lrp2	T	C	2: 69,510,502	M1010V	probably benign	Het
Magi3	C	A	3: 104,089,557	R224I	probably damaging	Het
Mier2	T	C	10: 79,544,739	N277S	probably damaging	Het
Morn1	A	G	4: 155,086,655	H17R	probably benign	Het
Nf2	A	T	11: 4,799,878	S265T	probably damaging	Het
Olfr1029	A	G	2: 85,975,356	T38A	possibly damaging	Het
Olfr1058	G	A	2: 86,385,680	T246I	possibly damaging	Het
Palb2	A	G	7: 122,127,047		probably null	Het
Pdzd2	C	T	15: 12,385,865	V940M	probably damaging	Het
Phldb2	T	C	16: 45,777,775	K850E	probably damaging	Het
Pitx1	G	A	13: 55,828,522	T108M	probably damaging	Het
Polr2a	C	T	11: 69,735,961	A1516T	probably benign	Het
Pomp	T	A	5: 147,875,503	M133K	possibly damaging	Het
Prex1	T	C	2: 166,581,993	E993G	probably damaging	Het
Prrc2c	C	A	1: 162,705,506		probably benign	Het
Pwp2	C	A	10: 78,172,083	Q879H	probably damaging	Het
Rab26	G	A	17: 24,529,792	T245I	probably damaging	Het
Rapgef1	A	G	2: 29,702,502	D502G	probably damaging	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Het
Sema5a	T	A	15: 32,550,275	D153E	probably benign	Het
Sez6	C	G	11: 77,953,559	H69Q	probably damaging	Het
Sgsm3	A	T	15: 81,008,894	T391S	probably benign	Het
Sh3rf2	T	C	18: 42,101,605	V151A	possibly damaging	Het
Socs1	G	T	16: 10,784,402	A157E	probably benign	Het
Sptbn4	C	A	7: 27,371,950	V346L	possibly damaging	Het
Srgap1	T	A	10: 121,785,618	H990L	probably damaging	Het
Tbc1d9	G	T	8: 83,166,180	G36W	probably damaging	Het
Tbk1	T	C	10: 121,559,877	E437G	probably benign	Het
Tns3	A	G	11: 8,531,743	L203P	probably damaging	Het
Tspoap1	A	T	11: 87,765,812	K283M	probably damaging	Het
Ttyh1	C	T	7: 4,124,650		probably benign	Het
Ufd1	T	A	16: 18,827,100	I254N	probably benign	Het
Ugdh	T	G	5: 65,427,433	T49P	probably benign	Het
Vav3	T	C	3: 109,527,494	L447P	probably damaging	Het
Vmn1r216	A	T	13: 23,099,275	K43*	probably null	Het
Vmn2r13	A	G	5: 109,158,149	I521T	possibly damaging	Het
Wdfy3	T	C	5: 101,844,066	T3470A	probably benign	Het
Wdhd1	T	A	14: 47,248,130	K791N	probably damaging	Het
Xirp2	A	G	2: 67,508,567	D384G	probably damaging	Het
Zfp512b	C	T	2: 181,590,480	R86Q	probably damaging	Het
Zfp735	A	C	11: 73,711,054	I275L	probably benign	Het
Zfp957	A	T	14: 79,213,904	S152T	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2018-11-06