Incidental Mutation 'R6898:Pramel7'
ID538438
Institutional Source Beutler Lab
Gene Symbol Pramel7
Ensembl Gene ENSMUSG00000025839
Gene Namepreferentially expressed antigen in melanoma like 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87489087-87497093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87489726 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 408 (T408A)
Ref Sequence ENSEMBL: ENSMUSP00000026957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026957]
Predicted Effect probably damaging
Transcript: ENSMUST00000026957
AA Change: T408A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026957
Gene: ENSMUSG00000025839
AA Change: T408A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 207 407 3e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Pramel7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Pramel7 APN 2 87491085 missense probably damaging 1.00
IGL01302:Pramel7 APN 2 87491373 missense possibly damaging 0.58
IGL01365:Pramel7 APN 2 87491413 splice site probably benign
IGL01728:Pramel7 APN 2 87491330 missense possibly damaging 0.95
IGL01769:Pramel7 APN 2 87489588 missense probably benign 0.09
IGL01932:Pramel7 APN 2 87491113 missense possibly damaging 0.80
IGL02971:Pramel7 APN 2 87490073 missense probably benign 0.03
IGL03376:Pramel7 APN 2 87489603 missense probably damaging 1.00
IGL03380:Pramel7 APN 2 87491372 missense probably benign 0.38
R0625:Pramel7 UTSW 2 87491008 missense probably benign 0.02
R1077:Pramel7 UTSW 2 87491190 missense probably damaging 1.00
R1455:Pramel7 UTSW 2 87489723 missense probably benign 0.00
R1666:Pramel7 UTSW 2 87492403 missense probably damaging 0.99
R1863:Pramel7 UTSW 2 87491331 missense probably benign 0.35
R1977:Pramel7 UTSW 2 87491121 missense probably benign 0.01
R2141:Pramel7 UTSW 2 87489977 missense probably damaging 1.00
R3027:Pramel7 UTSW 2 87491403 missense probably benign 0.01
R4374:Pramel7 UTSW 2 87490071 missense probably benign 0.05
R4735:Pramel7 UTSW 2 87490843 nonsense probably null
R5232:Pramel7 UTSW 2 87489976 missense probably damaging 0.97
R6255:Pramel7 UTSW 2 87489663 missense probably benign 0.00
R6611:Pramel7 UTSW 2 87490049 missense probably damaging 1.00
R7246:Pramel7 UTSW 2 87492165 missense probably damaging 1.00
R7293:Pramel7 UTSW 2 87492362 missense probably benign 0.28
R7408:Pramel7 UTSW 2 87490845 missense possibly damaging 0.89
R7431:Pramel7 UTSW 2 87489938 missense possibly damaging 0.65
R7469:Pramel7 UTSW 2 87491404 missense probably benign 0.01
R8300:Pramel7 UTSW 2 87489623 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGTTACTCCTGGCACAAAC -3'
(R):5'- CTAACCTGCAGACTCTGGAC -3'

Sequencing Primer
(F):5'- TGTTACTCCTGGCACAAACAAAGTG -3'
(R):5'- CCTGCAGACTCTGGACTTAGAAG -3'
Posted On2018-11-06