Mutagenetix > Incidental Mutation

Incidental Mutation 'R6898:Vps16'

538440

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R6898 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130437681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 38 (V38A)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028900
AA Change: V38A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: V38A

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128994
AA Change: V38A

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: V38A

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Meta Mutation Damage Score

0.2176

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.5%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,931,041	Y325F	probably damaging	Het
4430402I18Rik	T	G	19: 28,944,288	Q146P	probably benign	Het
Ankrd7	G	T	6: 18,868,101		probably null	Het
Aplnr	A	T	2: 85,139,811		probably benign	Het
Capns2	T	C	8: 92,901,977	S165P	probably damaging	Het
Col25a1	T	C	3: 130,584,728		probably null	Het
Crocc2	T	C	1: 93,215,582	V1302A	probably benign	Het
Cul9	C	A	17: 46,511,026	R1841M	possibly damaging	Het
Dnhd1	T	C	7: 105,687,377	L1213P	probably damaging	Het
Dscam	A	T	16: 96,829,900	I305K	probably benign	Het
Dsp	A	G	13: 38,192,217	E1326G	possibly damaging	Het
Emc9	A	G	14: 55,584,910		probably null	Het
Eppk1	A	C	15: 76,111,926	S252A	probably benign	Het
Fn1	T	A	1: 71,600,413	T1830S	probably damaging	Het
Fryl	A	T	5: 73,022,142	M2974K	probably damaging	Het
Gdpd3	C	A	7: 126,771,029	S250*	probably null	Het
Gm13088	A	T	4: 143,655,483	N214K	probably damaging	Het
Gm8994	T	A	6: 136,328,619	V26E	probably benign	Het
Gnl3	A	T	14: 31,013,179	S485R	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Hsd17b3	T	C	13: 64,059,525	Y234C	probably benign	Het
Lima1	T	C	15: 99,781,267	H271R	possibly damaging	Het
Nfu1	G	A	6: 87,017,052		probably null	Het
Noto	A	G	6: 85,427,960	E97G	probably damaging	Het
Ntng1	T	C	3: 109,872,218	K348E	probably damaging	Het
Olfr1242	C	T	2: 89,494,250	G21R	possibly damaging	Het
Olfr1383	G	A	11: 49,523,709		probably benign	Het
Osmr	C	A	15: 6,815,883	V801F	probably damaging	Het
Papln	A	G	12: 83,777,460	E554G	probably benign	Het
Pitrm1	T	C	13: 6,555,459	L175P	probably damaging	Het
Pramel7	T	C	2: 87,489,726	T408A	probably damaging	Het
Serinc2	A	T	4: 130,255,442	D322E	probably benign	Het
Setx	T	C	2: 29,148,108	V1535A	probably benign	Het
Sgce	A	T	6: 4,689,666	V389E	probably damaging	Het
Snx11	G	A	11: 96,769,062	T267I	probably benign	Het
Specc1	G	A	11: 62,118,336	S306N	probably benign	Het
Spocd1	A	G	4: 129,956,512		probably benign	Het
St7	T	A	6: 17,854,946	V294D	probably damaging	Het
Stab1	C	T	14: 31,158,963	R624Q	probably benign	Het
Tcf21	T	C	10: 22,819,504	I134V	probably benign	Het
Tgfb2	T	A	1: 186,632,500	I266F	probably damaging	Het
Tgfbr3l	A	G	8: 4,250,365	I209M	possibly damaging	Het
Tmcc3	A	G	10: 94,551,172		probably null	Het
Toe1	A	G	4: 116,807,474	S16P	probably damaging	Het
Wnk2	G	T	13: 49,071,081	D1001E	probably damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
R9092:Vps16	UTSW	2	130439673	missense	probably damaging	0.99
R9128:Vps16	UTSW	2	130424399	missense	possibly damaging	0.51
R9352:Vps16	UTSW	2	130441903	critical splice donor site	probably null
R9406:Vps16	UTSW	2	130441505	critical splice donor site	probably null
R9508:Vps16	UTSW	2	130442441	missense	possibly damaging	0.94
R9800:Vps16	UTSW	2	130440485	missense	probably benign	0.02
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTCATGTGGGGAGGAAAAG -3'
(R):5'- AGAACCTCAGGACCCATGTAAG -3'

Sequencing Primer
(F):5'- GACTCCTCCACTAGATAAACGGTAG -3'
(R):5'- AAGGTAGGCCTCCTGGATCATTTAC -3'

Posted On

2018-11-06