Incidental Mutation 'R6898:Serinc2'
ID538445
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130255442 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 322 (D322E)
Ref Sequence ENSEMBL: ENSMUSP00000112535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374]
Predicted Effect probably benign
Transcript: ENSMUST00000105996
AA Change: D377E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: D377E

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120126
AA Change: D386E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: D386E

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122374
AA Change: D322E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232
AA Change: D322E

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4497:Serinc2 UTSW 4 130254054 missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R4987:Serinc2 UTSW 4 130263027 splice site probably null
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130255521 missense possibly damaging 0.91
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R7264:Serinc2 UTSW 4 130258259 missense probably benign 0.00
R7526:Serinc2 UTSW 4 130258790 missense probably benign 0.03
R7835:Serinc2 UTSW 4 130275487 missense unknown
Z1176:Serinc2 UTSW 4 130253995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACACCCATGAGTAGCTGG -3'
(R):5'- CAAGCCCATGCAGTACTGTG -3'

Sequencing Primer
(F):5'- CCCATGAGTAGCTGGGGGAAAC -3'
(R):5'- CAGTACTGTGATGGTTTCCAGACAC -3'
Posted On2018-11-06