Incidental Mutation 'R6898:Noto'
ID538452
Institutional Source Beutler Lab
Gene Symbol Noto
Ensembl Gene ENSMUSG00000068302
Gene Namenotochord homeobox
Synonymstc, MmNot, Not, Flh
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85423886-85428877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85427960 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 97 (E97G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045693] [ENSMUST00000089578]
Predicted Effect probably benign
Transcript: ENSMUST00000045693
SMART Domains Protein: ENSMUSP00000048537
Gene: ENSMUSG00000033706

DomainStartEndE-ValueType
SET 21 357 8.15e-14 SMART
low complexity region 392 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089578
AA Change: R194G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087006
Gene: ENSMUSG00000068302
AA Change: R194G

DomainStartEndE-ValueType
HOX 149 211 4.04e-22 SMART
low complexity region 213 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174469
AA Change: E97G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygous mutant mice display decreased tail length, a truncated or disrupted notochord, abnormal and missing vertebrae, occasional hindlimb paralysis and postnatal lethality, and abnormal somite and sclerotome development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Specc1 G A 11: 62,118,336 S306N probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Noto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Noto APN 6 85424210 missense probably benign 0.01
IGL03081:Noto APN 6 85424109 missense probably damaging 1.00
R1837:Noto UTSW 6 85424177 missense probably benign 0.00
R7188:Noto UTSW 6 85428065 missense possibly damaging 0.64
R7476:Noto UTSW 6 85425499 missense probably damaging 1.00
RF003:Noto UTSW 6 85424210 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTCTGTTTGTAACTCCTCTTAGA -3'
(R):5'- AGCCCATATAACTAAAGCCTCTT -3'

Sequencing Primer
(F):5'- AGAGTGCTTGCCTCAAATGC -3'
(R):5'- TGCTCGGTCCTTAACTGCC -3'
Posted On2018-11-06