Incidental Mutation 'R6898:Specc1'
ID538461
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6898 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62118336 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 306 (S306N)
Ref Sequence ENSEMBL: ENSMUSP00000144311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202905]
Predicted Effect probably benign
Transcript: ENSMUST00000049836
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092415
AA Change: S226N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: S226N

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108709
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201364
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201624
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201671
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201723
AA Change: S226N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331
AA Change: S226N

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202178
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202179
AA Change: S226N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: S226N

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202389
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202744
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202905
AA Change: S306N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: S306N

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 Y325F probably damaging Het
4430402I18Rik T G 19: 28,944,288 Q146P probably benign Het
Ankrd7 G T 6: 18,868,101 probably null Het
Aplnr A T 2: 85,139,811 probably benign Het
Capns2 T C 8: 92,901,977 S165P probably damaging Het
Col25a1 T C 3: 130,584,728 probably null Het
Crocc2 T C 1: 93,215,582 V1302A probably benign Het
Cul9 C A 17: 46,511,026 R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 L1213P probably damaging Het
Dscam A T 16: 96,829,900 I305K probably benign Het
Dsp A G 13: 38,192,217 E1326G possibly damaging Het
Emc9 A G 14: 55,584,910 probably null Het
Eppk1 A C 15: 76,111,926 S252A probably benign Het
Fn1 T A 1: 71,600,413 T1830S probably damaging Het
Fryl A T 5: 73,022,142 M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 S250* probably null Het
Gm13088 A T 4: 143,655,483 N214K probably damaging Het
Gm8994 T A 6: 136,328,619 V26E probably benign Het
Gnl3 A T 14: 31,013,179 S485R probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 Y234C probably benign Het
Lima1 T C 15: 99,781,267 H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 probably null Het
Noto A G 6: 85,427,960 E97G probably damaging Het
Ntng1 T C 3: 109,872,218 K348E probably damaging Het
Olfr1242 C T 2: 89,494,250 G21R possibly damaging Het
Olfr1383 G A 11: 49,523,709 probably benign Het
Osmr C A 15: 6,815,883 V801F probably damaging Het
Papln A G 12: 83,777,460 E554G probably benign Het
Pitrm1 T C 13: 6,555,459 L175P probably damaging Het
Pramel7 T C 2: 87,489,726 T408A probably damaging Het
Serinc2 A T 4: 130,255,442 D322E probably benign Het
Setx T C 2: 29,148,108 V1535A probably benign Het
Sgce A T 6: 4,689,666 V389E probably damaging Het
Snx11 G A 11: 96,769,062 T267I probably benign Het
Spocd1 A G 4: 129,956,512 probably benign Het
St7 T A 6: 17,854,946 V294D probably damaging Het
Stab1 C T 14: 31,158,963 R624Q probably benign Het
Tcf21 T C 10: 22,819,504 I134V probably benign Het
Tgfb2 T A 1: 186,632,500 I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 probably null Het
Toe1 A G 4: 116,807,474 S16P probably damaging Het
Vps16 T C 2: 130,437,681 V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 D1001E probably damaging Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAAGAGCTTGCTGACCTAGAGG -3'
(R):5'- TGCCAAGGACAGCTCACTTG -3'

Sequencing Primer
(F):5'- CTTGCTGACCTAGAGGAAGAAAAC -3'
(R):5'- AGGACAGCTCACTTGCATTG -3'
Posted On2018-11-06