Incidental Mutation 'R6898:Papln'
ID 538463
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Name papilin, proteoglycan-like sulfated glycoprotein
Synonyms E030033C16Rik
MMRRC Submission 044992-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6898 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 83763634-83792382 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83777460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 554 (E554G)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
AlphaFold Q9EPX2
Predicted Effect probably benign
Transcript: ENSMUST00000021646
AA Change: E532G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: E532G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121733
AA Change: E554G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: E554G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Meta Mutation Damage Score 0.1525 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,041 (GRCm38) Y325F probably damaging Het
Ankrd7 G T 6: 18,868,101 (GRCm38) probably null Het
Aplnr A T 2: 85,139,811 (GRCm38) probably benign Het
Capns2 T C 8: 92,901,977 (GRCm38) S165P probably damaging Het
Col25a1 T C 3: 130,584,728 (GRCm38) probably null Het
Crocc2 T C 1: 93,215,582 (GRCm38) V1302A probably benign Het
Cul9 C A 17: 46,511,026 (GRCm38) R1841M possibly damaging Het
Dnhd1 T C 7: 105,687,377 (GRCm38) L1213P probably damaging Het
Dscam A T 16: 96,829,900 (GRCm38) I305K probably benign Het
Dsp A G 13: 38,192,217 (GRCm38) E1326G possibly damaging Het
Eif4a3l1 T A 6: 136,328,619 (GRCm38) V26E probably benign Het
Emc9 A G 14: 55,584,910 (GRCm38) probably null Het
Eppk1 A C 15: 76,111,926 (GRCm38) S252A probably benign Het
Fn1 T A 1: 71,600,413 (GRCm38) T1830S probably damaging Het
Fryl A T 5: 73,022,142 (GRCm38) M2974K probably damaging Het
Gdpd3 C A 7: 126,771,029 (GRCm38) S250* probably null Het
Gnl3 A T 14: 31,013,179 (GRCm38) S485R probably benign Het
Gpt2 G A 8: 85,518,052 (GRCm38) E325K probably benign Het
Hsd17b3 T C 13: 64,059,525 (GRCm38) Y234C probably benign Het
Lima1 T C 15: 99,781,267 (GRCm38) H271R possibly damaging Het
Nfu1 G A 6: 87,017,052 (GRCm38) probably null Het
Noto A G 6: 85,427,960 (GRCm38) E97G probably damaging Het
Ntng1 T C 3: 109,872,218 (GRCm38) K348E probably damaging Het
Or2y13 G A 11: 49,523,709 (GRCm38) probably benign Het
Or4a70 C T 2: 89,494,250 (GRCm38) G21R possibly damaging Het
Osmr C A 15: 6,815,883 (GRCm38) V801F probably damaging Het
Pitrm1 T C 13: 6,555,459 (GRCm38) L175P probably damaging Het
Pramel22 A T 4: 143,655,483 (GRCm38) N214K probably damaging Het
Pramel7 T C 2: 87,489,726 (GRCm38) T408A probably damaging Het
Serinc2 A T 4: 130,255,442 (GRCm38) D322E probably benign Het
Setx T C 2: 29,148,108 (GRCm38) V1535A probably benign Het
Sgce A T 6: 4,689,666 (GRCm38) V389E probably damaging Het
Snx11 G A 11: 96,769,062 (GRCm38) T267I probably benign Het
Spata6l T G 19: 28,944,288 (GRCm38) Q146P probably benign Het
Specc1 G A 11: 62,118,336 (GRCm38) S306N probably benign Het
Spocd1 A G 4: 129,956,512 (GRCm38) probably benign Het
St7 T A 6: 17,854,946 (GRCm38) V294D probably damaging Het
Stab1 C T 14: 31,158,963 (GRCm38) R624Q probably benign Het
Tcf21 T C 10: 22,819,504 (GRCm38) I134V probably benign Het
Tgfb2 T A 1: 186,632,500 (GRCm38) I266F probably damaging Het
Tgfbr3l A G 8: 4,250,365 (GRCm38) I209M possibly damaging Het
Tmcc3 A G 10: 94,551,172 (GRCm38) probably null Het
Toe1 A G 4: 116,807,474 (GRCm38) S16P probably damaging Het
Vps16 T C 2: 130,437,681 (GRCm38) V38A possibly damaging Het
Wnk2 G T 13: 49,071,081 (GRCm38) D1001E probably damaging Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83,770,436 (GRCm38) missense possibly damaging 0.81
IGL01788:Papln APN 12 83,775,462 (GRCm38) missense probably benign 0.32
IGL01889:Papln APN 12 83,786,835 (GRCm38) missense probably benign 0.25
IGL02499:Papln APN 12 83,780,671 (GRCm38) missense probably benign 0.00
IGL02567:Papln APN 12 83,778,837 (GRCm38) missense probably benign 0.00
IGL03150:Papln APN 12 83,782,984 (GRCm38) missense probably damaging 1.00
IGL03331:Papln APN 12 83,783,661 (GRCm38) missense probably benign
F5770:Papln UTSW 12 83,778,834 (GRCm38) missense possibly damaging 0.72
R0201:Papln UTSW 12 83,783,027 (GRCm38) splice site probably benign
R0389:Papln UTSW 12 83,783,379 (GRCm38) nonsense probably null
R0763:Papln UTSW 12 83,791,865 (GRCm38) missense possibly damaging 0.54
R1508:Papln UTSW 12 83,782,916 (GRCm38) missense probably damaging 0.99
R1628:Papln UTSW 12 83,784,406 (GRCm38) splice site probably benign
R1920:Papln UTSW 12 83,789,254 (GRCm38) nonsense probably null
R1974:Papln UTSW 12 83,782,037 (GRCm38) missense probably damaging 0.98
R2004:Papln UTSW 12 83,773,218 (GRCm38) missense probably damaging 1.00
R2105:Papln UTSW 12 83,780,236 (GRCm38) missense probably benign 0.04
R2876:Papln UTSW 12 83,778,927 (GRCm38) missense probably damaging 0.96
R4199:Papln UTSW 12 83,783,392 (GRCm38) missense probably null 0.01
R4702:Papln UTSW 12 83,781,983 (GRCm38) missense probably benign 0.01
R4705:Papln UTSW 12 83,777,208 (GRCm38) splice site probably null
R4835:Papln UTSW 12 83,774,420 (GRCm38) missense probably damaging 0.99
R4874:Papln UTSW 12 83,777,143 (GRCm38) missense probably benign 0.01
R4938:Papln UTSW 12 83,782,903 (GRCm38) missense probably benign 0.35
R5000:Papln UTSW 12 83,774,889 (GRCm38) missense probably damaging 1.00
R5149:Papln UTSW 12 83,771,882 (GRCm38) splice site probably null
R5324:Papln UTSW 12 83,774,571 (GRCm38) missense probably damaging 1.00
R5784:Papln UTSW 12 83,781,980 (GRCm38) missense probably benign
R5881:Papln UTSW 12 83,771,878 (GRCm38) missense probably null 0.91
R5977:Papln UTSW 12 83,784,369 (GRCm38) nonsense probably null
R6035:Papln UTSW 12 83,774,680 (GRCm38) missense probably damaging 1.00
R6035:Papln UTSW 12 83,774,680 (GRCm38) missense probably damaging 1.00
R6291:Papln UTSW 12 83,783,015 (GRCm38) missense probably benign 0.01
R6461:Papln UTSW 12 83,781,813 (GRCm38) splice site probably null
R6536:Papln UTSW 12 83,781,887 (GRCm38) missense probably damaging 1.00
R6861:Papln UTSW 12 83,774,949 (GRCm38) missense probably damaging 1.00
R6953:Papln UTSW 12 83,781,885 (GRCm38) nonsense probably null
R7155:Papln UTSW 12 83,776,521 (GRCm38) missense probably damaging 1.00
R7450:Papln UTSW 12 83,780,171 (GRCm38) missense probably benign 0.13
R7510:Papln UTSW 12 83,772,173 (GRCm38) missense probably damaging 0.99
R7850:Papln UTSW 12 83,780,662 (GRCm38) missense probably damaging 1.00
R7977:Papln UTSW 12 83,775,382 (GRCm38) missense probably damaging 1.00
R7987:Papln UTSW 12 83,775,382 (GRCm38) missense probably damaging 1.00
R8321:Papln UTSW 12 83,774,941 (GRCm38) nonsense probably null
R8324:Papln UTSW 12 83,786,619 (GRCm38) missense probably damaging 1.00
R8466:Papln UTSW 12 83,778,481 (GRCm38) critical splice acceptor site probably null
R8743:Papln UTSW 12 83,782,990 (GRCm38) missense probably damaging 1.00
R8790:Papln UTSW 12 83,777,144 (GRCm38) missense probably benign 0.01
R9086:Papln UTSW 12 83,774,859 (GRCm38) missense probably damaging 1.00
R9291:Papln UTSW 12 83,778,510 (GRCm38) missense probably benign 0.01
R9350:Papln UTSW 12 83,786,864 (GRCm38) missense probably damaging 1.00
R9438:Papln UTSW 12 83,771,832 (GRCm38) missense probably benign
R9484:Papln UTSW 12 83,791,844 (GRCm38) missense probably benign 0.05
V7580:Papln UTSW 12 83,778,834 (GRCm38) missense possibly damaging 0.72
V7581:Papln UTSW 12 83,778,834 (GRCm38) missense possibly damaging 0.72
V7582:Papln UTSW 12 83,778,834 (GRCm38) missense possibly damaging 0.72
Z1088:Papln UTSW 12 83,776,376 (GRCm38) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAATGCCTTCTGTCCAGGTCTG -3'
(R):5'- CAACACACTGGGCAAGTTTG -3'

Sequencing Primer
(F):5'- ACTTTGAAGAGTGTGGTCCCCTC -3'
(R):5'- CACACTGGGCAAGTTTGAGTTCAC -3'
Posted On 2018-11-06